EMAIL THIS PAGE TO A FRIEND

MTBP

Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa

Synonyms: MDM2BP
UniProtKB ID: Q96DY7, Q9HA89
Gene ID:
Human(27085) Summary: This gene encodes a protein that interacts with the oncoprotein mouse double minute 2. The encoded protein regulates progression through the cell cycle and may be involved in tumor formation. [provided by RefSeq, Aug 2012]
Mouse(105837) Mdm2, transformed 3T3 cell double minute p53 binding protein
Rat(500870) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
chicken(420354) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
dog(609080) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
Horse(100057261) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
cow(617904) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
domestic cat(101099179) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
sheep(101116918) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
domestic guinea pig(100723512) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
naked mole-rat(101714982) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
Domestic Rabbit(100354267) Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022045 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036191 MISSION® esiRNA esiRNA human MTBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022045 Rosetta Predictions human pricing
NM_001130717 Rosetta Predictions rat pricing
XM_576269 Rosetta Predictions rat pricing
NM_134092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164348 predicted 2319
2 SASI_Hs01_00164350 predicted 254
3 SASI_Hs01_00164351 predicted 2715
4 SASI_Hs02_00355393 predicted 2263
5 SASI_Hs01_00164352 predicted 1271
6 SASI_Hs01_00164353 predicted 395
7 SASI_Hs01_00164354 predicted 1116
8 SASI_Hs02_00355394 predicted 2257
9 SASI_Hs02_00355395 predicted 242
10 SASI_Hs02_00355396 predicted 1329
11 SASI_Hs01_00164346 predicted 1113
12 SASI_Hs01_00164347 predicted 2648
13 SASI_Hs01_00164349 predicted 690
14 SASI_Hs01_00164355 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256049 predicted 1403
2 SASI_Rn02_00256050 predicted 1925
3 SASI_Rn02_00256051 predicted 1738
4 SASI_Rn02_00256052 predicted 2626
5 SASI_Rn02_00256053 predicted 846
6 SASI_Rn02_00256054 predicted 2295
7 SASI_Rn02_00256055 predicted 463
8 SASI_Rn02_00256056 predicted 1222
9 SASI_Rn02_00256057 predicted 3005
10 SASI_Rn02_00256058 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00133112 predicted 817
2 SASI_Rn01_00133113 predicted 1012
3 SASI_Rn01_00133114 predicted 548
4 SASI_Rn01_00133115 predicted 776
5 SASI_Rn01_00133116 predicted 886
6 SASI_Rn01_00133117 predicted 1049
7 SASI_Rn01_00133118 predicted 621
8 SASI_Rn01_00133119 predicted 704
9 SASI_Rn01_00133120 predicted 759
10 SASI_Rn01_00133121 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339317 predicted 1654
2 SASI_Mm01_00049039 predicted 1792
3 SASI_Mm01_00049040 predicted 869
4 SASI_Mm01_00049041 predicted 1004
5 SASI_Mm01_00049042 predicted 1739
6 SASI_Mm01_00049043 predicted 702
7 SASI_Mm02_00339318 predicted 425
8 SASI_Mm01_00049044 predicted 2149
9 SASI_Mm01_00049045 predicted 1261
10 SASI_Mm02_00339319 predicted 2446
11 SASI_Mm01_00049036 predicted 542
12 SASI_Mm01_00049037 predicted 712
13 SASI_Mm01_00049038 predicted 1868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134092
VALIDATED
MTBP MISSION shRNA Bacterial Glycerol Stock
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-1792s1c1
Sequence:CCGGGCGTGGTAAATGATGACGGTACTCGAGTACCGTCATCATTTACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-2481s1c1
Sequence:CCGGGCGAGTTGCAATAGTAATCATCTCGAGATGATTACTATTGCAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-1263s1c1
Sequence:CCGGCCGTGTACTGTTAGCAATGTACTCGAGTACATTGCTAACAGTACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-1807s21c1
Sequence:CCGGACGGTACAGTTGAACCTTATTCTCGAGAATAAGGTTCAACTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-625s21c1
Sequence:CCGGTACCCTTGGCTGACCTATATGCTCGAGCATATAGGTCAGCCAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134092.2-1011s21c1
Sequence:CCGGACGAATGTTAGTGCGTATAATCTCGAGATTATACGCACTAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134092.2-2950s1c1
Sequence:CCGGCAAAGAGCAGATGCCTCATTTCTCGAGAAATGAGGCATCTGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-331s21c1
Sequence:CCGGATTTGACCGCAACCAATATTTCTCGAGAAATATTGGTTGCGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-2984s21c1
Sequence:CCGGATGGTGTCCTGTATCTATATACTCGAGTATATAGATACAGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134092
VALIDATED
MTBP MISSION shRNA shRNA Plasmid DNA
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-1792s1c1
Sequence:CCGGGCGTGGTAAATGATGACGGTACTCGAGTACCGTCATCATTTACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-2481s1c1
Sequence:CCGGGCGAGTTGCAATAGTAATCATCTCGAGATGATTACTATTGCAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-1263s1c1
Sequence:CCGGCCGTGTACTGTTAGCAATGTACTCGAGTACATTGCTAACAGTACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-1807s21c1
Sequence:CCGGACGGTACAGTTGAACCTTATTCTCGAGAATAAGGTTCAACTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-625s21c1
Sequence:CCGGTACCCTTGGCTGACCTATATGCTCGAGCATATAGGTCAGCCAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134092.2-1011s21c1
Sequence:CCGGACGAATGTTAGTGCGTATAATCTCGAGATTATACGCACTAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134092.2-2950s1c1
Sequence:CCGGCAAAGAGCAGATGCCTCATTTCTCGAGAAATGAGGCATCTGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-331s21c1
Sequence:CCGGATTTGACCGCAACCAATATTTCTCGAGAAATATTGGTTGCGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-2984s21c1
Sequence:CCGGATGGTGTCCTGTATCTATATACTCGAGTATATAGATACAGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134092
VALIDATED
MTBP MISSION shRNA Lentiviral Transduction Particles
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-1792s1c1
Sequence:CCGGGCGTGGTAAATGATGACGGTACTCGAGTACCGTCATCATTTACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-2481s1c1
Sequence:CCGGGCGAGTTGCAATAGTAATCATCTCGAGATGATTACTATTGCAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134092.2-1263s1c1
Sequence:CCGGCCGTGTACTGTTAGCAATGTACTCGAGTACATTGCTAACAGTACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-1807s21c1
Sequence:CCGGACGGTACAGTTGAACCTTATTCTCGAGAATAAGGTTCAACTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-625s21c1
Sequence:CCGGTACCCTTGGCTGACCTATATGCTCGAGCATATAGGTCAGCCAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134092.2-1011s21c1
Sequence:CCGGACGAATGTTAGTGCGTATAATCTCGAGATTATACGCACTAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134092.2-2950s1c1
Sequence:CCGGCAAAGAGCAGATGCCTCATTTCTCGAGAAATGAGGCATCTGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-331s21c1
Sequence:CCGGATTTGACCGCAACCAATATTTCTCGAGAAATATTGGTTGCGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134092.2-2984s21c1
Sequence:CCGGATGGTGTCCTGTATCTATATACTCGAGTATATAGATACAGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022045
MTBP MISSION shRNA Bacterial Glycerol Stock
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1307s1c1
Sequence:CCGGCCAACCAGATCAATGGCTCATCTCGAGATGAGCCATTGATCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-438s1c1
Sequence:CCGGCAGTAATAGCAGGGAATCATTCTCGAGAATGATTCCCTGCTATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1113s1c1
Sequence:CCGGGCCATGTACCATTAGTAACATCTCGAGATGTTACTAATGGTACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-2567s1c1
Sequence:CCGGCCCTGAAGAAACACAGTATTACTCGAGTAATACTGTGTTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1308s1c1
Sequence:CCGGCAACCAGATCAATGGCTCATTCTCGAGAATGAGCCATTGATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-375s21c1
Sequence:CCGGAGATGTTCTTCAAACGAATATCTCGAGATATTCGTTTGAAGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-1231s21c1
Sequence:CCGGGGAGAGTGTTCTAGCTATTATCTCGAGATAATAGCTAGAACACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022045.3-2789s21c1
Sequence:CCGGTAAATTGGATGGAGCTATTATCTCGAGATAATAGCTCCATCCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-2242s21c1
Sequence:CCGGCGATTGAAACGGAGATCTAAACTCGAGTTTAGATCTCCGTTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022045
MTBP MISSION shRNA shRNA Plasmid DNA
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1307s1c1
Sequence:CCGGCCAACCAGATCAATGGCTCATCTCGAGATGAGCCATTGATCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-438s1c1
Sequence:CCGGCAGTAATAGCAGGGAATCATTCTCGAGAATGATTCCCTGCTATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1113s1c1
Sequence:CCGGGCCATGTACCATTAGTAACATCTCGAGATGTTACTAATGGTACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-2567s1c1
Sequence:CCGGCCCTGAAGAAACACAGTATTACTCGAGTAATACTGTGTTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1308s1c1
Sequence:CCGGCAACCAGATCAATGGCTCATTCTCGAGAATGAGCCATTGATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-375s21c1
Sequence:CCGGAGATGTTCTTCAAACGAATATCTCGAGATATTCGTTTGAAGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-1231s21c1
Sequence:CCGGGGAGAGTGTTCTAGCTATTATCTCGAGATAATAGCTAGAACACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022045.3-2789s21c1
Sequence:CCGGTAAATTGGATGGAGCTATTATCTCGAGATAATAGCTCCATCCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-2242s21c1
Sequence:CCGGCGATTGAAACGGAGATCTAAACTCGAGTTTAGATCTCCGTTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022045
MTBP MISSION shRNA Lentiviral Transduction Particles
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1307s1c1
Sequence:CCGGCCAACCAGATCAATGGCTCATCTCGAGATGAGCCATTGATCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-438s1c1
Sequence:CCGGCAGTAATAGCAGGGAATCATTCTCGAGAATGATTCCCTGCTATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1113s1c1
Sequence:CCGGGCCATGTACCATTAGTAACATCTCGAGATGTTACTAATGGTACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-2567s1c1
Sequence:CCGGCCCTGAAGAAACACAGTATTACTCGAGTAATACTGTGTTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022045.2-1308s1c1
Sequence:CCGGCAACCAGATCAATGGCTCATTCTCGAGAATGAGCCATTGATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-375s21c1
Sequence:CCGGAGATGTTCTTCAAACGAATATCTCGAGATATTCGTTTGAAGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-1231s21c1
Sequence:CCGGGGAGAGTGTTCTAGCTATTATCTCGAGATAATAGCTAGAACACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022045.3-2789s21c1
Sequence:CCGGTAAATTGGATGGAGCTATTATCTCGAGATAATAGCTCCATCCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022045.3-2242s21c1
Sequence:CCGGCGATTGAAACGGAGATCTAAACTCGAGTTTAGATCTCCGTTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks