EMAIL THIS PAGE TO A FRIEND

MTERFD2

MTERF domain containing 2

Synonyms: MTERF4
UniProtKB ID: Q7Z6M4, Q9P0E0
Gene ID:
Mouse(69821) MTERF domain containing 2
Rat(363289) MTERF domain containing 2
sheep(101121891) MTERF domain containing 2
naked mole-rat(101712149) MTERF domain containing 2
domestic guinea pig(100731669) MTERF domain containing 2
dog(609495) MTERF domain containing 2
Horse(100067594) MTERF domain containing 2
cow(512153) MTERF domain containing 2
domestic cat(101096091) MTERF domain containing 2
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA027097 Anti-MTERF4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500829 Anti-MTERFD2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182501 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033371 MISSION® esiRNA esiRNA human MTERFD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182501 Rosetta Predictions human pricing
NM_001037209 Rosetta Predictions rat pricing
NM_178051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215187 predicted 348
2 SASI_Hs01_00215188 predicted 486
3 SASI_Hs01_00215189 predicted 772
4 SASI_Hs01_00215190 predicted 479
5 SASI_Hs01_00215191 predicted 745
6 SASI_Hs01_00215193 predicted 789
7 SASI_Hs01_00215194 predicted 338
8 SASI_Hs01_00215195 predicted 354
9 SASI_Hs01_00215196 predicted 494
10 SASI_Hs02_00370554 predicted 738
11 SASI_Hs01_00215192 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088192 predicted 204
2 SASI_Rn01_00088193 predicted 362
3 SASI_Rn01_00088194 predicted 373
4 SASI_Rn01_00088195 predicted 569
5 SASI_Rn01_00088196 predicted 239
6 SASI_Rn01_00088197 predicted 352
7 SASI_Rn02_00204324 predicted 358
8 SASI_Rn01_00088200 predicted 399
9 SASI_Rn01_00088201 predicted 373
10 SASI_Rn02_00204325 predicted 329
11 SASI_Rn01_00088198 predicted 287
12 SASI_Rn01_00088199 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082479 predicted 596
2 SASI_Mm01_00082480 predicted 1548
3 SASI_Mm01_00082481 predicted 1409
4 SASI_Mm01_00082482 predicted 1500
5 SASI_Mm01_00082483 predicted 511
6 SASI_Mm01_00082484 predicted 756
7 SASI_Mm01_00082485 predicted 492
8 SASI_Mm01_00082486 predicted 1448
9 SASI_Mm01_00082487 predicted 426
10 SASI_Mm01_00082488 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182501
VALIDATED
MTERFD2 MISSION shRNA Bacterial Glycerol Stock
MTERF domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-624s21c1
Sequence:CCGGATGCGCCAGCAGGACATTAACCTCGAGGTTAATGTCCTGCTGGCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-839s21c1
Sequence:CCGGGATTAAGCAGAGACACATTTACTCGAGTAAATGTGTCTCTGCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-224s21c1
Sequence:CCGGATCTTGTGTTAGATCCAATAACTCGAGTTATTGGATCTAACACAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-367s21c1
Sequence:CCGGGTTTCAGCAATGCCCATATTACTCGAGTAATATGGGCATTGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182501.2-3832s1c1
Sequence:CCGGCGCGCTATATCGGCCATTAAACTCGAGTTTAATGGCCGATATAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182501.2-714s1c1
Sequence:CCGGCCTGGGTCAACTGGAATACAACTCGAGTTGTATTCCAGTTGACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182501.2-1414s1c1
Sequence:CCGGCCATCCTGAATAAGATACTTACTCGAGTAAGTATCTTATTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182501.2-558s1c1
Sequence:CCGGGAAATTAAAGAGGGTGCTTTACTCGAGTAAAGCACCCTCTTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182501.2-409s1c1
Sequence:CCGGCTGGACATCATTTCAGAATTTCTCGAGAAATTCTGAAATGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182501
VALIDATED
MTERFD2 MISSION shRNA shRNA Plasmid DNA
MTERF domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-624s21c1
Sequence:CCGGATGCGCCAGCAGGACATTAACCTCGAGGTTAATGTCCTGCTGGCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-839s21c1
Sequence:CCGGGATTAAGCAGAGACACATTTACTCGAGTAAATGTGTCTCTGCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-224s21c1
Sequence:CCGGATCTTGTGTTAGATCCAATAACTCGAGTTATTGGATCTAACACAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-367s21c1
Sequence:CCGGGTTTCAGCAATGCCCATATTACTCGAGTAATATGGGCATTGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182501.2-3832s1c1
Sequence:CCGGCGCGCTATATCGGCCATTAAACTCGAGTTTAATGGCCGATATAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182501.2-714s1c1
Sequence:CCGGCCTGGGTCAACTGGAATACAACTCGAGTTGTATTCCAGTTGACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182501.2-1414s1c1
Sequence:CCGGCCATCCTGAATAAGATACTTACTCGAGTAAGTATCTTATTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182501.2-558s1c1
Sequence:CCGGGAAATTAAAGAGGGTGCTTTACTCGAGTAAAGCACCCTCTTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182501.2-409s1c1
Sequence:CCGGCTGGACATCATTTCAGAATTTCTCGAGAAATTCTGAAATGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182501
VALIDATED
MTERFD2 MISSION shRNA Lentiviral Transduction Particles
MTERF domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-624s21c1
Sequence:CCGGATGCGCCAGCAGGACATTAACCTCGAGGTTAATGTCCTGCTGGCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-839s21c1
Sequence:CCGGGATTAAGCAGAGACACATTTACTCGAGTAAATGTGTCTCTGCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-224s21c1
Sequence:CCGGATCTTGTGTTAGATCCAATAACTCGAGTTATTGGATCTAACACAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182501.3-367s21c1
Sequence:CCGGGTTTCAGCAATGCCCATATTACTCGAGTAATATGGGCATTGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182501.2-3832s1c1
Sequence:CCGGCGCGCTATATCGGCCATTAAACTCGAGTTTAATGGCCGATATAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182501.2-714s1c1
Sequence:CCGGCCTGGGTCAACTGGAATACAACTCGAGTTGTATTCCAGTTGACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182501.2-1414s1c1
Sequence:CCGGCCATCCTGAATAAGATACTTACTCGAGTAAGTATCTTATTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182501.2-558s1c1
Sequence:CCGGGAAATTAAAGAGGGTGCTTTACTCGAGTAAAGCACCCTCTTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182501.2-409s1c1
Sequence:CCGGCTGGACATCATTTCAGAATTTCTCGAGAAATTCTGAAATGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178051
MTERFD2 MISSION shRNA Bacterial Glycerol Stock
MTERF domain containing 2
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000216908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178051.3-2940s1c1
Sequence:CCGGGCTGATTCCACTATGACATTTCTCGAGAAATGTCATAGTGGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178051
MTERFD2 MISSION shRNA shRNA Plasmid DNA
MTERF domain containing 2
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000216908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178051.3-2940s1c1
Sequence:CCGGGCTGATTCCACTATGACATTTCTCGAGAAATGTCATAGTGGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178051
MTERFD2 MISSION shRNA Lentiviral Transduction Particles
MTERF domain containing 2
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000216908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178051.3-2940s1c1
Sequence:CCGGGCTGATTCCACTATGACATTTCTCGAGAAATGTCATAGTGGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024463
VALIDATED
MTERFD2 MISSION shRNA Bacterial Glycerol Stock
MTERF domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-148s1c1
Sequence:CCGGCCTTGGAGAAGGGAAACTGAACTCGAGTTCAGTTTCCCTTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-317s1c1
Sequence:CCGGCCCAACGAGCTAGAATACAAACTCGAGTTTGTATTCTAGCTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-418s1c1
Sequence:CCGGGATCAAGCAGAGACACATTTACTCGAGTAAATGTGTCTCTGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-325s1c1
Sequence:CCGGGCTAGAATACAAATTCCAGTACTCGAGTACTGGAATTTGTATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-358s1c1
Sequence:CCGGGATGGGACTCACACATCTAGACTCGAGTCTAGATGTGTGAGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-340s1c1
Sequence:CCGGCCAGTATGCATATTTCAGGATCTCGAGATCCTGAAATATGCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024463.1-520s1c1
Sequence:CCGGCAGAGTTTCTGAAGCTGAGTTCTCGAGAACTCAGCTTCAGAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024463
VALIDATED
MTERFD2 MISSION shRNA shRNA Plasmid DNA
MTERF domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-148s1c1
Sequence:CCGGCCTTGGAGAAGGGAAACTGAACTCGAGTTCAGTTTCCCTTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-317s1c1
Sequence:CCGGCCCAACGAGCTAGAATACAAACTCGAGTTTGTATTCTAGCTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-418s1c1
Sequence:CCGGGATCAAGCAGAGACACATTTACTCGAGTAAATGTGTCTCTGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-325s1c1
Sequence:CCGGGCTAGAATACAAATTCCAGTACTCGAGTACTGGAATTTGTATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-358s1c1
Sequence:CCGGGATGGGACTCACACATCTAGACTCGAGTCTAGATGTGTGAGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-340s1c1
Sequence:CCGGCCAGTATGCATATTTCAGGATCTCGAGATCCTGAAATATGCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024463.1-520s1c1
Sequence:CCGGCAGAGTTTCTGAAGCTGAGTTCTCGAGAACTCAGCTTCAGAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024463
VALIDATED
MTERFD2 MISSION shRNA Lentiviral Transduction Particles
MTERF domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-148s1c1
Sequence:CCGGCCTTGGAGAAGGGAAACTGAACTCGAGTTCAGTTTCCCTTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-317s1c1
Sequence:CCGGCCCAACGAGCTAGAATACAAACTCGAGTTTGTATTCTAGCTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024463.1-418s1c1
Sequence:CCGGGATCAAGCAGAGACACATTTACTCGAGTAAATGTGTCTCTGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-325s1c1
Sequence:CCGGGCTAGAATACAAATTCCAGTACTCGAGTACTGGAATTTGTATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-358s1c1
Sequence:CCGGGATGGGACTCACACATCTAGACTCGAGTCTAGATGTGTGAGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024463.1-340s1c1
Sequence:CCGGCCAGTATGCATATTTCAGGATCTCGAGATCCTGAAATATGCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024463.1-520s1c1
Sequence:CCGGCAGAGTTTCTGAAGCTGAGTTCTCGAGAACTCAGCTTCAGAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks