EMAIL THIS PAGE TO A FRIEND

MTFR2

mitochondrial fission regulator 2

Synonyms: DUFD1 FAM54A
Gene ID:
Mouse(71804) mitochondrial fission regulator 2
cow(534254) family with sequence similarity 54, member A
naked mole-rat(101715108) mitochondrial fission regulator 2
domestic guinea pig(100721880) mitochondrial fission regulator 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052221 MISSION® esiRNA esiRNA human FAM54A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099286 Rosetta Predictions human pricing
NM_138419 Rosetta Predictions human pricing
NM_027930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320419 predicted 781
2 SASI_Hs02_00320420 predicted 579
3 SASI_Hs02_00320421 predicted 558
4 SASI_Hs02_00320422 predicted 660
5 SASI_Hs02_00320423 predicted 783
6 SASI_Hs02_00320424 predicted 584
7 SASI_Hs02_00320425 predicted 1549
8 SASI_Hs02_00320426 predicted 1449
9 SASI_Hs02_00320427 predicted 644
10 SASI_Hs02_00320428 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363559 predicted 498
2 SASI_Hs01_00104442 predicted 295
3 SASI_Hs01_00104445 predicted 275
4 SASI_Hs01_00104446 predicted 373
5 SASI_Hs01_00104447 predicted 498
6 SASI_Hs01_00104448 predicted 296
7 SASI_Hs01_00104449 predicted 1264
8 SASI_Hs01_00104451 predicted 1161
9 SASI_Hs02_00363560 predicted 362
10 SASI_Hs02_00363561 predicted 464
11 SASI_Hs01_00104443 predicted 205
12 SASI_Hs01_00104444 predicted 201
13 SASI_Hs01_00104450 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129676 predicted 241
2 SASI_Mm01_00129677 predicted 241
3 SASI_Mm01_00129679 predicted 411
4 SASI_Mm01_00129680 predicted 348
5 SASI_Mm01_00129681 predicted 1233
6 SASI_Mm01_00129682 predicted 196
7 SASI_Mm01_00129683 predicted 1200
8 SASI_Mm02_00332908 predicted 1464
9 SASI_Mm01_00129684 predicted 406
10 SASI_Mm01_00129685 predicted 1387
11 SASI_Mm01_00129678 predicted 1174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138419
VALIDATED
MTFR2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission regulator 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-626s21c1
Sequence:CCGGGCTTGAGTGACGAGCGCATTACTCGAGTAATGCGCTCGTCACTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-368s21c1
Sequence:CCGGGTTATCTCAGATTTCGAAATACTCGAGTATTTCGAAATCTGAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-785s21c1
Sequence:CCGGCCGTACAACCAGGATCTAATACTCGAGTATTAGATCCTGGTTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-1168s21c1
Sequence:CCGGTCAGAAGGACAGCGAACTAAACTCGAGTTTAGTTCGCTGTCCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-846s21c1
Sequence:CCGGACAGAACCCGGCTGCTAATAACTCGAGTTATTAGCAGCCGGGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-574s1c1
Sequence:CCGGGCAATTGTGGAAATGCAGGAACTCGAGTTCCTGCATTTCCACAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-308s1c1
Sequence:CCGGGTGGATCTATGGTTCCATCTTCTCGAGAAGATGGAACCATAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138419.2-1262s1c1
Sequence:CCGGCTCAACTTAAGGTTGAGCTTTCTCGAGAAAGCTCAACCTTAAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-913s1c1
Sequence:CCGGCCAAACATGTTGGACGTTCTACTCGAGTAGAACGTCCAACATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1273s1c1
Sequence:CCGGGTTGAGCTTTAAACTTCCAAACTCGAGTTTGGAAGTTTAAAGCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1264s1c1
Sequence:CCGGCAACTTAAGGTTGAGCTTTAACTCGAGTTAAAGCTCAACCTTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167377    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1323s1c1
Sequence:CCGGGAAACTGATTTGGACTGTTAACTCGAGTTAACAGTCCAAATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138419
VALIDATED
MTFR2 MISSION shRNA shRNA Plasmid DNA
mitochondrial fission regulator 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-626s21c1
Sequence:CCGGGCTTGAGTGACGAGCGCATTACTCGAGTAATGCGCTCGTCACTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-368s21c1
Sequence:CCGGGTTATCTCAGATTTCGAAATACTCGAGTATTTCGAAATCTGAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-785s21c1
Sequence:CCGGCCGTACAACCAGGATCTAATACTCGAGTATTAGATCCTGGTTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-1168s21c1
Sequence:CCGGTCAGAAGGACAGCGAACTAAACTCGAGTTTAGTTCGCTGTCCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-846s21c1
Sequence:CCGGACAGAACCCGGCTGCTAATAACTCGAGTTATTAGCAGCCGGGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-574s1c1
Sequence:CCGGGCAATTGTGGAAATGCAGGAACTCGAGTTCCTGCATTTCCACAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-308s1c1
Sequence:CCGGGTGGATCTATGGTTCCATCTTCTCGAGAAGATGGAACCATAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138419.2-1262s1c1
Sequence:CCGGCTCAACTTAAGGTTGAGCTTTCTCGAGAAAGCTCAACCTTAAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-913s1c1
Sequence:CCGGCCAAACATGTTGGACGTTCTACTCGAGTAGAACGTCCAACATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1273s1c1
Sequence:CCGGGTTGAGCTTTAAACTTCCAAACTCGAGTTTGGAAGTTTAAAGCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1264s1c1
Sequence:CCGGCAACTTAAGGTTGAGCTTTAACTCGAGTTAAAGCTCAACCTTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167377    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1323s1c1
Sequence:CCGGGAAACTGATTTGGACTGTTAACTCGAGTTAACAGTCCAAATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138419
VALIDATED
MTFR2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission regulator 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-626s21c1
Sequence:CCGGGCTTGAGTGACGAGCGCATTACTCGAGTAATGCGCTCGTCACTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-368s21c1
Sequence:CCGGGTTATCTCAGATTTCGAAATACTCGAGTATTTCGAAATCTGAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-785s21c1
Sequence:CCGGCCGTACAACCAGGATCTAATACTCGAGTATTAGATCCTGGTTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-1168s21c1
Sequence:CCGGTCAGAAGGACAGCGAACTAAACTCGAGTTTAGTTCGCTGTCCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138419.3-846s21c1
Sequence:CCGGACAGAACCCGGCTGCTAATAACTCGAGTTATTAGCAGCCGGGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-574s1c1
Sequence:CCGGGCAATTGTGGAAATGCAGGAACTCGAGTTCCTGCATTTCCACAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-308s1c1
Sequence:CCGGGTGGATCTATGGTTCCATCTTCTCGAGAAGATGGAACCATAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138419.2-1262s1c1
Sequence:CCGGCTCAACTTAAGGTTGAGCTTTCTCGAGAAAGCTCAACCTTAAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138419.2-913s1c1
Sequence:CCGGCCAAACATGTTGGACGTTCTACTCGAGTAGAACGTCCAACATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1273s1c1
Sequence:CCGGGTTGAGCTTTAAACTTCCAAACTCGAGTTTGGAAGTTTAAAGCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1264s1c1
Sequence:CCGGCAACTTAAGGTTGAGCTTTAACTCGAGTTAAAGCTCAACCTTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167377    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138419.2-1323s1c1
Sequence:CCGGGAAACTGATTTGGACTGTTAACTCGAGTTAACAGTCCAAATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027930
VALIDATED
MTFR2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission regulator 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.3-1056s1c1
Sequence:CCGGCCAGTGTCTTTAATATCTAATCTCGAGATTAGATATTAAAGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.3-132s1c1
Sequence:CCGGCTTCCTTCACCAATGTCTTTCCTCGAGGAAAGACATTGGTGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027930.3-1625s21c1
Sequence:CCGGGAGCAGAAGATGATATTGTTTCTCGAGAAACAATATCATCTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-410s21c1
Sequence:CCGGTTGTCTCAGATTTCGACATAGCTCGAGCTATGTCGAAATCTGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-330s21c1
Sequence:CCGGTCTACGGAGTCTGATGATTATCTCGAGATAATCATCAGACTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-246s21c1
Sequence:CCGGCGGAGTATTGTTCGTATTATTCTCGAGAATAATACGAACAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-546s21c1
Sequence:CCGGGTAAATGAAGCTGCAATTAAACTCGAGTTTAATTGCAGCTTCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.1-537s1c1
Sequence:CCGGGCCTGTAAATGAAGCTGCAATCTCGAGATTGCAGCTTCATTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-241s1c1
Sequence:CCGGCGGAGTATTGTTCGTATTATTCTCGAGAATAATACGAACAATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1174s1c1
Sequence:CCGGCATCACATTCTCCAACAGAAACTCGAGTTTCTGTTGGAGAATGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1090s1c1
Sequence:CCGGGCATTTCAAGATGATTCCTTTCTCGAGAAAGGAATCATCTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1620s1c1
Sequence:CCGGGAGCAGAAGATGATATTGTTTCTCGAGAAACAATATCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-499s1c1
Sequence:CCGGCCTGGTCTAAGACAGAACAAACTCGAGTTTGTTCTGTCTTAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027930
VALIDATED
MTFR2 MISSION shRNA shRNA Plasmid DNA
mitochondrial fission regulator 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.3-1056s1c1
Sequence:CCGGCCAGTGTCTTTAATATCTAATCTCGAGATTAGATATTAAAGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.3-132s1c1
Sequence:CCGGCTTCCTTCACCAATGTCTTTCCTCGAGGAAAGACATTGGTGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027930.3-1625s21c1
Sequence:CCGGGAGCAGAAGATGATATTGTTTCTCGAGAAACAATATCATCTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-410s21c1
Sequence:CCGGTTGTCTCAGATTTCGACATAGCTCGAGCTATGTCGAAATCTGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-330s21c1
Sequence:CCGGTCTACGGAGTCTGATGATTATCTCGAGATAATCATCAGACTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-246s21c1
Sequence:CCGGCGGAGTATTGTTCGTATTATTCTCGAGAATAATACGAACAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-546s21c1
Sequence:CCGGGTAAATGAAGCTGCAATTAAACTCGAGTTTAATTGCAGCTTCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.1-537s1c1
Sequence:CCGGGCCTGTAAATGAAGCTGCAATCTCGAGATTGCAGCTTCATTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-241s1c1
Sequence:CCGGCGGAGTATTGTTCGTATTATTCTCGAGAATAATACGAACAATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1174s1c1
Sequence:CCGGCATCACATTCTCCAACAGAAACTCGAGTTTCTGTTGGAGAATGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1090s1c1
Sequence:CCGGGCATTTCAAGATGATTCCTTTCTCGAGAAAGGAATCATCTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1620s1c1
Sequence:CCGGGAGCAGAAGATGATATTGTTTCTCGAGAAACAATATCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-499s1c1
Sequence:CCGGCCTGGTCTAAGACAGAACAAACTCGAGTTTGTTCTGTCTTAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027930
VALIDATED
MTFR2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission regulator 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.3-1056s1c1
Sequence:CCGGCCAGTGTCTTTAATATCTAATCTCGAGATTAGATATTAAAGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.3-132s1c1
Sequence:CCGGCTTCCTTCACCAATGTCTTTCCTCGAGGAAAGACATTGGTGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027930.3-1625s21c1
Sequence:CCGGGAGCAGAAGATGATATTGTTTCTCGAGAAACAATATCATCTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-410s21c1
Sequence:CCGGTTGTCTCAGATTTCGACATAGCTCGAGCTATGTCGAAATCTGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-330s21c1
Sequence:CCGGTCTACGGAGTCTGATGATTATCTCGAGATAATCATCAGACTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-246s21c1
Sequence:CCGGCGGAGTATTGTTCGTATTATTCTCGAGAATAATACGAACAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027930.3-546s21c1
Sequence:CCGGGTAAATGAAGCTGCAATTAAACTCGAGTTTAATTGCAGCTTCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027930.1-537s1c1
Sequence:CCGGGCCTGTAAATGAAGCTGCAATCTCGAGATTGCAGCTTCATTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-241s1c1
Sequence:CCGGCGGAGTATTGTTCGTATTATTCTCGAGAATAATACGAACAATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1174s1c1
Sequence:CCGGCATCACATTCTCCAACAGAAACTCGAGTTTCTGTTGGAGAATGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1090s1c1
Sequence:CCGGGCATTTCAAGATGATTCCTTTCTCGAGAAAGGAATCATCTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-1620s1c1
Sequence:CCGGGAGCAGAAGATGATATTGTTTCTCGAGAAACAATATCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027930.1-499s1c1
Sequence:CCGGCCTGGTCTAAGACAGAACAAACTCGAGTTTGTTCTGTCTTAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks