EMAIL THIS PAGE TO A FRIEND

MTMR10

myotubularin related protein 10

UniProtKB ID: Q9NXD2, Q6P4Q6
Gene ID:
Mouse(233315) myotubularin related protein 10
Rat(309255) myotubularin related protein 10
Zebrafish(555239) myotubularin related protein 10
chicken(415382) myotubularin related protein 10
cow(615443) myotubularin related protein 10
Horse(100050568) myotubularin related protein 10
dog(479016) myotubularin related protein 10
domestic cat(101086654) myotubularin related protein 10
domestic guinea pig(100719255) myotubularin related protein 10
naked mole-rat(101722215) myotubularin related protein 10
sheep(101118477) myotubularin related protein 10
173 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA006081 Anti-MTMR10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017762 Rosetta Predictions human pricing
XM_001058490 Rosetta Predictions rat pricing
XM_219705 Rosetta Predictions rat pricing
NM_172742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350587 predicted 1636
2 SASI_Hs01_00038986 predicted 1010
3 SASI_Hs01_00038987 predicted 1178
4 SASI_Hs01_00038988 predicted 1381
5 SASI_Hs01_00038989 predicted 1422
6 SASI_Hs01_00038990 predicted 403
7 SASI_Hs02_00350588 predicted 321
8 SASI_Hs01_00038992 predicted 1591
9 SASI_Hs01_00038993 predicted 1320
10 SASI_Hs01_00038994 predicted 1416
11 SASI_Hs01_00038985 predicted 1118
12 SASI_Hs01_00038991 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289919 predicted 1332
2 SASI_Rn02_00289920 predicted 515
3 SASI_Rn02_00289921 predicted 1190
4 SASI_Rn02_00289922 predicted 534
5 SASI_Rn02_00289923 predicted 2181
6 SASI_Rn02_00289924 predicted 1240
7 SASI_Rn02_00289925 predicted 2571
8 SASI_Rn02_00289926 predicted 2362
9 SASI_Rn02_00289927 predicted 2167
10 SASI_Rn02_00289928 predicted 2067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378599 predicted 1333
2 SASI_Rn02_00378600 predicted 515
3 SASI_Rn02_00378601 predicted 1182
4 SASI_Rn02_00378602 predicted 534
5 SASI_Rn02_00378603 predicted 2182
6 SASI_Rn02_00378604 predicted 1237
7 SASI_Rn02_00378605 predicted 2566
8 SASI_Rn02_00378606 predicted 2361
9 SASI_Rn02_00378607 predicted 2166
10 SASI_Rn02_00378608 predicted 2067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344572 predicted 1464
2 SASI_Mm01_00198215 predicted 1908
3 SASI_Mm01_00198216 predicted 2025
4 SASI_Mm02_00344573 predicted 300
5 SASI_Mm01_00198217 predicted 2409
6 SASI_Mm02_00344574 predicted 1421
7 SASI_Mm02_00344575 predicted 668
8 SASI_Mm02_00344576 predicted 454
9 SASI_Mm02_00344577 predicted 588
10 SASI_Mm02_00344578 predicted 757
11 SASI_Mm01_00198214 predicted 955
12 SASI_Mm01_00198218 predicted 1100
13 SASI_Mm01_00198219 predicted 1144
14 SASI_Mm01_00198220 predicted 1043
15 SASI_Mm01_00198221 predicted 829
16 SASI_Mm01_00198222 predicted 1344
17 SASI_Mm01_00198223 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017762
VALIDATED
MTMR10 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017762.1-1806s1c1
Sequence:CCGGCCAACAACAGAAGCTGACAAACTCGAGTTTGTCAGCTTCTGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017762.1-1028s1c1
Sequence:CCGGCCAGAGGATTTGTAATGCAATCTCGAGATTGCATTACAAATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_017762.1-1151s1c1
Sequence:CCGGGCTATGCGTTAATGAGCCTTTCTCGAGAAAGGCTCATTAACGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017762.1-627s1c1
Sequence:CCGGGCATTTGAATATGTTGGGAAACTCGAGTTTCCCAACATATTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017762.1-1029s1c1
Sequence:CCGGCAGAGGATTTGTAATGCAATACTCGAGTATTGCATTACAAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-1096s21c1
Sequence:CCGGATAAGACCTTGCCTAATATTCCTCGAGGAATATTAGGCAAGGTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-1352s21c1
Sequence:CCGGAGTGATGCTGGATCCCTATTTCTCGAGAAATAGGGATCCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-173s21c1
Sequence:CCGGCAATTCGGAACCGAAGATTAACTCGAGTTAATCTTCGGTTCCGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017762
VALIDATED
MTMR10 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017762.1-1806s1c1
Sequence:CCGGCCAACAACAGAAGCTGACAAACTCGAGTTTGTCAGCTTCTGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017762.1-1028s1c1
Sequence:CCGGCCAGAGGATTTGTAATGCAATCTCGAGATTGCATTACAAATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_017762.1-1151s1c1
Sequence:CCGGGCTATGCGTTAATGAGCCTTTCTCGAGAAAGGCTCATTAACGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017762.1-627s1c1
Sequence:CCGGGCATTTGAATATGTTGGGAAACTCGAGTTTCCCAACATATTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017762.1-1029s1c1
Sequence:CCGGCAGAGGATTTGTAATGCAATACTCGAGTATTGCATTACAAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-1096s21c1
Sequence:CCGGATAAGACCTTGCCTAATATTCCTCGAGGAATATTAGGCAAGGTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-1352s21c1
Sequence:CCGGAGTGATGCTGGATCCCTATTTCTCGAGAAATAGGGATCCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-173s21c1
Sequence:CCGGCAATTCGGAACCGAAGATTAACTCGAGTTAATCTTCGGTTCCGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017762
VALIDATED
MTMR10 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017762.1-1806s1c1
Sequence:CCGGCCAACAACAGAAGCTGACAAACTCGAGTTTGTCAGCTTCTGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017762.1-1028s1c1
Sequence:CCGGCCAGAGGATTTGTAATGCAATCTCGAGATTGCATTACAAATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_017762.1-1151s1c1
Sequence:CCGGGCTATGCGTTAATGAGCCTTTCTCGAGAAAGGCTCATTAACGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017762.1-627s1c1
Sequence:CCGGGCATTTGAATATGTTGGGAAACTCGAGTTTCCCAACATATTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017762.1-1029s1c1
Sequence:CCGGCAGAGGATTTGTAATGCAATACTCGAGTATTGCATTACAAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-1096s21c1
Sequence:CCGGATAAGACCTTGCCTAATATTCCTCGAGGAATATTAGGCAAGGTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-1352s21c1
Sequence:CCGGAGTGATGCTGGATCCCTATTTCTCGAGAAATAGGGATCCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_017762.2-173s21c1
Sequence:CCGGCAATTCGGAACCGAAGATTAACTCGAGTTAATCTTCGGTTCCGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172742
VALIDATED
MTMR10 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-949s1c1
Sequence:CCGGGTAGGAAATCTGTGTAGACGACTCGAGTCGTCTACACAGATTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-489s1c1
Sequence:CCGGCTCATGCTTGAAGAATGGGATCTCGAGATCCCATTCTTCAAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172742.1-637s1c1
Sequence:CCGGCCAGCCAACCTACACGGCATTCTCGAGAATGCCGTGTAGGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-91s1c1
Sequence:CCGGTCAGAGAAAGAGTCTCCTTTACTCGAGTAAAGGAGACTCTTTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-2510s1c1
Sequence:CCGGGCTCTTGTCTACTTATACAAACTCGAGTTTGTATAAGTAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2012s21c1
Sequence:CCGGCCAGCCAACCTACACGGCATTCTCGAGAATGCCGTGTAGGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-3885s21c1
Sequence:CCGGGCTCTTGTCTACTTATACAAACTCGAGTTTGTATAAGTAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-1466s21c1
Sequence:CCGGTCAGAGAAAGAGTCTCCTTTACTCGAGTAAAGGAGACTCTTTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2411s21c1
Sequence:CCGGCTAGCAAATGAAGACTAAATTCTCGAGAATTTAGTCTTCATTTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2324s21c1
Sequence:CCGGGTAGGAAATCTGTGTAGACGACTCGAGTCGTCTACACAGATTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172742
VALIDATED
MTMR10 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-949s1c1
Sequence:CCGGGTAGGAAATCTGTGTAGACGACTCGAGTCGTCTACACAGATTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-489s1c1
Sequence:CCGGCTCATGCTTGAAGAATGGGATCTCGAGATCCCATTCTTCAAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172742.1-637s1c1
Sequence:CCGGCCAGCCAACCTACACGGCATTCTCGAGAATGCCGTGTAGGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-91s1c1
Sequence:CCGGTCAGAGAAAGAGTCTCCTTTACTCGAGTAAAGGAGACTCTTTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-2510s1c1
Sequence:CCGGGCTCTTGTCTACTTATACAAACTCGAGTTTGTATAAGTAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2012s21c1
Sequence:CCGGCCAGCCAACCTACACGGCATTCTCGAGAATGCCGTGTAGGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-3885s21c1
Sequence:CCGGGCTCTTGTCTACTTATACAAACTCGAGTTTGTATAAGTAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-1466s21c1
Sequence:CCGGTCAGAGAAAGAGTCTCCTTTACTCGAGTAAAGGAGACTCTTTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2411s21c1
Sequence:CCGGCTAGCAAATGAAGACTAAATTCTCGAGAATTTAGTCTTCATTTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2324s21c1
Sequence:CCGGGTAGGAAATCTGTGTAGACGACTCGAGTCGTCTACACAGATTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172742
VALIDATED
MTMR10 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-949s1c1
Sequence:CCGGGTAGGAAATCTGTGTAGACGACTCGAGTCGTCTACACAGATTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-489s1c1
Sequence:CCGGCTCATGCTTGAAGAATGGGATCTCGAGATCCCATTCTTCAAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172742.1-637s1c1
Sequence:CCGGCCAGCCAACCTACACGGCATTCTCGAGAATGCCGTGTAGGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-91s1c1
Sequence:CCGGTCAGAGAAAGAGTCTCCTTTACTCGAGTAAAGGAGACTCTTTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172742.1-2510s1c1
Sequence:CCGGGCTCTTGTCTACTTATACAAACTCGAGTTTGTATAAGTAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2012s21c1
Sequence:CCGGCCAGCCAACCTACACGGCATTCTCGAGAATGCCGTGTAGGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-3885s21c1
Sequence:CCGGGCTCTTGTCTACTTATACAAACTCGAGTTTGTATAAGTAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-1466s21c1
Sequence:CCGGTCAGAGAAAGAGTCTCCTTTACTCGAGTAAAGGAGACTCTTTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2411s21c1
Sequence:CCGGCTAGCAAATGAAGACTAAATTCTCGAGAATTTAGTCTTCATTTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172742.2-2324s21c1
Sequence:CCGGGTAGGAAATCTGTGTAGACGACTCGAGTCGTCTACACAGATTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks