EMAIL THIS PAGE TO A FRIEND

MTMR12

myotubularin related protein 12

Synonyms: 3-PAP PIP3AP
UniProtKB ID: Q9C0I1, Q69YJ4, Q6PFW3, Q96QU2, Q9NX27
Gene ID:
Human(54545) Summary: Phosphatidylinositide 3-kinase-derived membrane-anchored phosphatidylinositides, such as phosphatidylinositol 3-phosphate (PtdIns(3)P), regulate diverse cellular processes. The protein encoded by this gene functions as an adaptor subunit in a complex with an active PtdIns(3)P 3-phosphatase. Alternatively spliced transcript variants have been identified, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(268783) myotubularin related protein 12
Rat(310155) myotubularin related protein 12
Zebrafish(569130) myotubularin related protein 12
domestic cat(101081195) myotubularin related protein 12
cow(541159) myotubularin related protein 12
Horse(100068591) myotubularin related protein 12
dog(612625) myotubularin related protein 12
chicken(427423) myotubularin related protein 12
domestic guinea pig(100717095) myotubularin related protein 12
naked mole-rat(101723945) myotubularin related protein 12
sheep(101115067) myotubularin related protein 12
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001040446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040446 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040446 Rosetta Predictions human pricing
NM_001012077 Rosetta Predictions rat pricing
XM_574868 Rosetta Predictions rat pricing
NM_172958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035616 predicted 2466
2 SASI_Hs01_00035617 predicted 427
3 SASI_Hs01_00035618 predicted 1861
4 SASI_Hs01_00035619 predicted 397
5 SASI_Hs01_00035620 predicted 683
6 SASI_Hs01_00035622 predicted 1582
7 SASI_Hs01_00035623 predicted 848
8 SASI_Hs02_00308985 predicted 1851
9 SASI_Hs01_00035624 predicted 2029
10 SASI_Hs01_00035625 predicted 1802
11 SASI_Hs01_00035621 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200194 predicted 1080
2 SASI_Rn01_00032681 predicted 1614
3 SASI_Rn02_00200195 predicted 951
4 SASI_Rn01_00032682 predicted 208
5 SASI_Rn01_00032684 predicted 1182
6 SASI_Rn01_00032686 predicted 1845
7 SASI_Rn01_00032689 predicted 1025
8 SASI_Rn01_00032690 predicted 1273
9 SASI_Rn02_00200196 predicted 1666
10 SASI_Rn02_00200197 predicted 1497
11 SASI_Rn01_00032683 predicted 1815
12 SASI_Rn01_00032685 predicted 1556
13 SASI_Rn01_00032687 predicted 1646
14 SASI_Rn01_00032688 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179703 predicted 1731
2 SASI_Rn01_00179704 predicted 1735
3 SASI_Rn01_00179705 predicted 2079
4 SASI_Rn01_00179706 predicted 1469
5 SASI_Rn01_00179707 predicted 1894
6 SASI_Rn01_00179708 predicted 1664
7 SASI_Rn01_00179709 predicted 1923
8 SASI_Rn01_00179710 predicted 1660
9 SASI_Rn01_00179711 predicted 2099
10 SASI_Rn01_00179712 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040884 predicted 1878
2 SASI_Mm01_00040886 predicted 1209
3 SASI_Mm02_00344992 predicted 2418
4 SASI_Mm01_00040888 predicted 886
5 SASI_Mm01_00040889 predicted 693
6 SASI_Mm01_00040890 predicted 1519
7 SASI_Mm01_00040891 predicted 391
8 SASI_Mm01_00040892 predicted 241
9 SASI_Mm01_00040893 predicted 478
10 SASI_Mm02_00344993 predicted 1779
11 SASI_Mm01_00040885 predicted 1397
12 SASI_Mm01_00040887 predicted 1706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019061
VALIDATED
MTMR12 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1906s1c1
Sequence:CCGGGCAAGAGAATTAGCAAACTTACTCGAGTAAGTTTGCTAATTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1797s1c1
Sequence:CCGGCGCTTCAAACATCAACGACAACTCGAGTTGTCGTTGATGTTTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1049s1c1
Sequence:CCGGGCCACCCTATGAAATTGTTAACTCGAGTTAACAATTTCATAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-4351s1c1
Sequence:CCGGGCCTTCTTAAATTAGCACTAACTCGAGTTAGTGCTAATTTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-736s1c1
Sequence:CCGGCCGTAATGTTTGACACACTTACTCGAGTAAGTGTGTCAAACATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019061
VALIDATED
MTMR12 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1906s1c1
Sequence:CCGGGCAAGAGAATTAGCAAACTTACTCGAGTAAGTTTGCTAATTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1797s1c1
Sequence:CCGGCGCTTCAAACATCAACGACAACTCGAGTTGTCGTTGATGTTTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1049s1c1
Sequence:CCGGGCCACCCTATGAAATTGTTAACTCGAGTTAACAATTTCATAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-4351s1c1
Sequence:CCGGGCCTTCTTAAATTAGCACTAACTCGAGTTAGTGCTAATTTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-736s1c1
Sequence:CCGGCCGTAATGTTTGACACACTTACTCGAGTAAGTGTGTCAAACATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019061
VALIDATED
MTMR12 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1906s1c1
Sequence:CCGGGCAAGAGAATTAGCAAACTTACTCGAGTAAGTTTGCTAATTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1797s1c1
Sequence:CCGGCGCTTCAAACATCAACGACAACTCGAGTTGTCGTTGATGTTTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-1049s1c1
Sequence:CCGGGCCACCCTATGAAATTGTTAACTCGAGTTAACAATTTCATAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-4351s1c1
Sequence:CCGGGCCTTCTTAAATTAGCACTAACTCGAGTTAGTGCTAATTTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019061.2-736s1c1
Sequence:CCGGCCGTAATGTTTGACACACTTACTCGAGTAAGTGTGTCAAACATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172958
VALIDATED
MTMR12 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172958.2-1771s1c1
Sequence:CCGGCGTTTCAAACATCAACGACAACTCGAGTTGTCGTTGATGTTTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172958.2-1086s1c1
Sequence:CCGGCCAGAGTGCATACTGTAAATTCTCGAGAATTTACAGTATGCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172958.2-1694s1c1
Sequence:CCGGCCAAAGCACAGACGTTACTTACTCGAGTAAGTAACGTCTGTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172958.2-1024s1c1
Sequence:CCGGCCACCCTACGAGATGGTTAAACTCGAGTTTAACCATCTCGTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172958.2-3612s1c1
Sequence:CCGGCCCTCCATAATAATGCACAATCTCGAGATTGTGCATTATTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-595s21c1
Sequence:CCGGAGGATCGTCAGTGGCATAATCCTCGAGGATTATGCCACTGACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172958.3-408s21c1
Sequence:CCGGGAATAAGATCATAGGAGTAAACTCGAGTTTACTCCTATGATCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-1876s21c1
Sequence:CCGGCTAGGCAAGAGAATTAGTAAACTCGAGTTTACTAATTCTCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-1123s21c1
Sequence:CCGGATAGATAACAGTTCGGAATTTCTCGAGAAATTCCGAACTGTTATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172958.3-2726s21c1
Sequence:CCGGGACTTAAACCATAGCATATTCCTCGAGGAATATGCTATGGTTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172958
VALIDATED
MTMR12 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172958.2-1771s1c1
Sequence:CCGGCGTTTCAAACATCAACGACAACTCGAGTTGTCGTTGATGTTTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172958.2-1086s1c1
Sequence:CCGGCCAGAGTGCATACTGTAAATTCTCGAGAATTTACAGTATGCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172958.2-1694s1c1
Sequence:CCGGCCAAAGCACAGACGTTACTTACTCGAGTAAGTAACGTCTGTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172958.2-1024s1c1
Sequence:CCGGCCACCCTACGAGATGGTTAAACTCGAGTTTAACCATCTCGTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172958.2-3612s1c1
Sequence:CCGGCCCTCCATAATAATGCACAATCTCGAGATTGTGCATTATTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-595s21c1
Sequence:CCGGAGGATCGTCAGTGGCATAATCCTCGAGGATTATGCCACTGACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172958.3-408s21c1
Sequence:CCGGGAATAAGATCATAGGAGTAAACTCGAGTTTACTCCTATGATCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-1876s21c1
Sequence:CCGGCTAGGCAAGAGAATTAGTAAACTCGAGTTTACTAATTCTCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-1123s21c1
Sequence:CCGGATAGATAACAGTTCGGAATTTCTCGAGAAATTCCGAACTGTTATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172958.3-2726s21c1
Sequence:CCGGGACTTAAACCATAGCATATTCCTCGAGGAATATGCTATGGTTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172958
VALIDATED
MTMR12 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172958.2-1771s1c1
Sequence:CCGGCGTTTCAAACATCAACGACAACTCGAGTTGTCGTTGATGTTTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172958.2-1086s1c1
Sequence:CCGGCCAGAGTGCATACTGTAAATTCTCGAGAATTTACAGTATGCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172958.2-1694s1c1
Sequence:CCGGCCAAAGCACAGACGTTACTTACTCGAGTAAGTAACGTCTGTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172958.2-1024s1c1
Sequence:CCGGCCACCCTACGAGATGGTTAAACTCGAGTTTAACCATCTCGTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172958.2-3612s1c1
Sequence:CCGGCCCTCCATAATAATGCACAATCTCGAGATTGTGCATTATTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-595s21c1
Sequence:CCGGAGGATCGTCAGTGGCATAATCCTCGAGGATTATGCCACTGACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172958.3-408s21c1
Sequence:CCGGGAATAAGATCATAGGAGTAAACTCGAGTTTACTCCTATGATCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-1876s21c1
Sequence:CCGGCTAGGCAAGAGAATTAGTAAACTCGAGTTTACTAATTCTCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172958.3-1123s21c1
Sequence:CCGGATAGATAACAGTTCGGAATTTCTCGAGAAATTCCGAACTGTTATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172958.3-2726s21c1
Sequence:CCGGGACTTAAACCATAGCATATTCCTCGAGGAATATGCTATGGTTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040446
MTMR12 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-657s21c1
Sequence:CCGGAGGATTGTCAGTGGCATAATTCTCGAGAATTATGCCACTGACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040446.1-4690s21c1
Sequence:CCGGTGAATGTGCATTGACATATTTCTCGAGAAATATGTCAATGCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-1863s21c1
Sequence:GTACCGGTTGCCACTTACACAATCTAAGCTCGAGCTTAGATTGTGTAAGTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-852s21c1
Sequence:GTACCGGAGTGTCAACGAAGGCTATAAACTCGAGTTTATAGCCTTCGTTGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-694s21c1
Sequence:CCGGCTAAACTGCTTAAACGATTATCTCGAGATAATCGTTTAAGCAGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040446
MTMR12 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-657s21c1
Sequence:CCGGAGGATTGTCAGTGGCATAATTCTCGAGAATTATGCCACTGACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040446.1-4690s21c1
Sequence:CCGGTGAATGTGCATTGACATATTTCTCGAGAAATATGTCAATGCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-1863s21c1
Sequence:GTACCGGTTGCCACTTACACAATCTAAGCTCGAGCTTAGATTGTGTAAGTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-852s21c1
Sequence:GTACCGGAGTGTCAACGAAGGCTATAAACTCGAGTTTATAGCCTTCGTTGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-694s21c1
Sequence:CCGGCTAAACTGCTTAAACGATTATCTCGAGATAATCGTTTAAGCAGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040446
MTMR12 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-657s21c1
Sequence:CCGGAGGATTGTCAGTGGCATAATTCTCGAGAATTATGCCACTGACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040446.1-4690s21c1
Sequence:CCGGTGAATGTGCATTGACATATTTCTCGAGAAATATGTCAATGCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-1863s21c1
Sequence:GTACCGGTTGCCACTTACACAATCTAAGCTCGAGCTTAGATTGTGTAAGTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-852s21c1
Sequence:GTACCGGAGTGTCAACGAAGGCTATAAACTCGAGTTTATAGCCTTCGTTGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040446.1-694s21c1
Sequence:CCGGCTAAACTGCTTAAACGATTATCTCGAGATAATCGTTTAAGCAGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks