EMAIL THIS PAGE TO A FRIEND

MTO1

mitochondrial tRNA translation optimization 1

Synonyms: COXPD10
Gene ID:
Human(25821) Summary: This gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The encoded protein may also play a role in the expression of the non-syndromic and aminoglycoside-induced deafness phenotypes associated with a specific mutation in the mitochondrial 12S rRNA gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(68291) mitochondrial translation optimization 1 homolog (S. cerevisiae)
Rat(300852) mitochondrial tRNA translation optimization 1
Zebrafish(100009640) mitochondrial translation optimization 1 homolog (S. cerevisiae)
cow(535768) mitochondrial translation optimization 1 homolog (S. cerevisiae)
domestic cat(101092856) mitochondrial translation optimization 1 homolog (S. cerevisiae)
dog(474967) mitochondrial translation optimization 1 homolog (S. cerevisiae)
chicken(772297) mitochondrial translation optimization 1 homolog (S. cerevisiae)
Thale Cress(821292) cystathionine gamma-synthase
sheep(101109280) mitochondrial translation optimization 1 homolog (S. cerevisiae)
domestic guinea pig(100714255) mitochondrial tRNA translation optimization 1
naked mole-rat(101718418) mitochondrial tRNA translation optimization 1
Domestic Rabbit(100328659) mitochondrial translation optimization 1 homolog (S. cerevisiae)
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012123 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123226 Rosetta Predictions human pricing
NM_012123 Rosetta Predictions human pricing
NM_133645 Rosetta Predictions human pricing
NM_001106841 Rosetta Predictions rat pricing
NM_026658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327745 predicted 716
2 SASI_Hs02_00327746 predicted 498
3 SASI_Hs02_00327747 predicted 2291
4 SASI_Hs02_00327748 predicted 1746
5 SASI_Hs02_00327749 predicted 1792
6 SASI_Hs02_00327750 predicted 2113
7 SASI_Hs02_00327751 predicted 2304
8 SASI_Hs02_00327752 predicted 1760
9 SASI_Hs02_00327753 predicted 1999
10 SASI_Hs02_00327754 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045449 predicted 716
2 SASI_Hs02_00343668 predicted 501
3 SASI_Hs01_00045450 predicted 2179
4 SASI_Hs01_00045451 predicted 1626
5 SASI_Hs01_00045452 predicted 1665
6 SASI_Hs02_00343669 predicted 1991
7 SASI_Hs01_00045454 predicted 2191
8 SASI_Hs01_00045455 predicted 1638
9 SASI_Hs01_00045456 predicted 1871
10 SASI_Hs02_00343670 predicted 1818
11 SASI_Hs01_00045453 predicted 1421
12 SASI_Hs01_00045457 predicted 985
13 SASI_Hs01_00045458 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138104 predicted 717
2 SASI_Hs02_00363286 predicted 500
3 SASI_Hs01_00138105 predicted 2249
4 SASI_Hs01_00138106 predicted 1699
5 SASI_Hs01_00138107 predicted 1744
6 SASI_Hs02_00363287 predicted 2070
7 SASI_Hs01_00138109 predicted 2265
8 SASI_Hs01_00138110 predicted 1712
9 SASI_Hs01_00138111 predicted 1955
10 SASI_Hs02_00363288 predicted 1897
11 SASI_Hs01_00138108 predicted 1496
12 SASI_Hs01_00138112 predicted 979
13 SASI_Hs01_00138113 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222926 predicted 1913
2 SASI_Rn02_00222927 predicted 1778
3 SASI_Rn02_00222928 predicted 812
4 SASI_Rn02_00222929 predicted 1581
5 SASI_Rn02_00222930 predicted 1887
6 SASI_Rn02_00222931 predicted 1893
7 SASI_Rn02_00222932 predicted 1203
8 SASI_Rn02_00222933 predicted 963
9 SASI_Rn02_00222934 predicted 297
10 SASI_Rn02_00222935 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116447 predicted 1680
2 SASI_Mm01_00116448 predicted 1057
3 SASI_Mm01_00116450 predicted 1212
4 SASI_Mm01_00116451 predicted 2091
5 SASI_Mm01_00116452 predicted 1268
6 SASI_Mm02_00330648 predicted 809
7 SASI_Mm01_00116454 predicted 1791
8 SASI_Mm01_00116455 predicted 301
9 SASI_Mm02_00330649 predicted 672
10 SASI_Mm01_00116456 predicted 917
11 SASI_Mm01_00116449 predicted 650
12 SASI_Mm01_00116453 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012123
VALIDATED
MTO1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial tRNA translation optimization 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-1685s1c1
Sequence:CCGGGCTCTCGATGTTCTGAAGTATCTCGAGATACTTCAGAACATCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012123.1-2004s1c1
Sequence:CCGGCCATCATCAATCTGCTGAGATCTCGAGATCTCAGCAGATTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-843s1c1
Sequence:CCGGGCTTTACCAATGAGACAGTATCTCGAGATACTGTCTCATTGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012123.1-1748s1c1
Sequence:CCGGCCCTTGAAGAAGTATACTAAACTCGAGTTTAGTATACTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-1176s1c1
Sequence:CCGGGCTACGGTGTTCAGTATGATTCTCGAGAATCATACTGAACACCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-1503s21c1
Sequence:CCGGGTGAACCATACCGCATGTTTACTCGAGTAAACATGCGGTATGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012123.3-2309s21c1
Sequence:CCGGTACTATGGGTTTGCCATTAATCTCGAGATTAATGGCAAACCCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-876s21c1
Sequence:CCGGGTATTCTAAACAAGCATATACCTCGAGGTATATGCTTGTTTAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-1255s21c1
Sequence:CCGGCTACGGTGTTCAGTATGATTACTCGAGTAATCATACTGAACACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-851s21c1
Sequence:CCGGATTGCCAAAGAGTCCATTAATCTCGAGATTAATGGACTCTTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012123
VALIDATED
MTO1 MISSION shRNA shRNA Plasmid DNA
mitochondrial tRNA translation optimization 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-1685s1c1
Sequence:CCGGGCTCTCGATGTTCTGAAGTATCTCGAGATACTTCAGAACATCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012123.1-2004s1c1
Sequence:CCGGCCATCATCAATCTGCTGAGATCTCGAGATCTCAGCAGATTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-843s1c1
Sequence:CCGGGCTTTACCAATGAGACAGTATCTCGAGATACTGTCTCATTGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012123.1-1748s1c1
Sequence:CCGGCCCTTGAAGAAGTATACTAAACTCGAGTTTAGTATACTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-1176s1c1
Sequence:CCGGGCTACGGTGTTCAGTATGATTCTCGAGAATCATACTGAACACCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-1503s21c1
Sequence:CCGGGTGAACCATACCGCATGTTTACTCGAGTAAACATGCGGTATGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012123.3-2309s21c1
Sequence:CCGGTACTATGGGTTTGCCATTAATCTCGAGATTAATGGCAAACCCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-876s21c1
Sequence:CCGGGTATTCTAAACAAGCATATACCTCGAGGTATATGCTTGTTTAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-1255s21c1
Sequence:CCGGCTACGGTGTTCAGTATGATTACTCGAGTAATCATACTGAACACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-851s21c1
Sequence:CCGGATTGCCAAAGAGTCCATTAATCTCGAGATTAATGGACTCTTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012123
VALIDATED
MTO1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial tRNA translation optimization 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-1685s1c1
Sequence:CCGGGCTCTCGATGTTCTGAAGTATCTCGAGATACTTCAGAACATCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012123.1-2004s1c1
Sequence:CCGGCCATCATCAATCTGCTGAGATCTCGAGATCTCAGCAGATTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-843s1c1
Sequence:CCGGGCTTTACCAATGAGACAGTATCTCGAGATACTGTCTCATTGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012123.1-1748s1c1
Sequence:CCGGCCCTTGAAGAAGTATACTAAACTCGAGTTTAGTATACTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_012123.1-1176s1c1
Sequence:CCGGGCTACGGTGTTCAGTATGATTCTCGAGAATCATACTGAACACCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-1503s21c1
Sequence:CCGGGTGAACCATACCGCATGTTTACTCGAGTAAACATGCGGTATGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012123.3-2309s21c1
Sequence:CCGGTACTATGGGTTTGCCATTAATCTCGAGATTAATGGCAAACCCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-876s21c1
Sequence:CCGGGTATTCTAAACAAGCATATACCTCGAGGTATATGCTTGTTTAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-1255s21c1
Sequence:CCGGCTACGGTGTTCAGTATGATTACTCGAGTAATCATACTGAACACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012123.3-851s21c1
Sequence:CCGGATTGCCAAAGAGTCCATTAATCTCGAGATTAATGGACTCTTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026658
VALIDATED
MTO1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial tRNA translation optimization 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2109s1c1
Sequence:CCGGGCTTGTGAACTTTCATTTCATCTCGAGATGAAATGAAAGTTCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026658.1-407s1c1
Sequence:CCGGCAAAGTGCTAAACCGGCGTAACTCGAGTTACGCCGGTTTAGCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2105s1c1
Sequence:CCGGCGGTGCTTGTGAACTTTCATTCTCGAGAATGAAAGTTCACAAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2172s1c1
Sequence:CCGGCGTAATACAGTTCCTTGTGTTCTCGAGAACACAAGGAACTGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-1020s1c1
Sequence:CCGGCCCTCTATTGAATCAAAGGTTCTCGAGAACCTTTGATTCAATAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026658
VALIDATED
MTO1 MISSION shRNA shRNA Plasmid DNA
mitochondrial tRNA translation optimization 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2109s1c1
Sequence:CCGGGCTTGTGAACTTTCATTTCATCTCGAGATGAAATGAAAGTTCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026658.1-407s1c1
Sequence:CCGGCAAAGTGCTAAACCGGCGTAACTCGAGTTACGCCGGTTTAGCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2105s1c1
Sequence:CCGGCGGTGCTTGTGAACTTTCATTCTCGAGAATGAAAGTTCACAAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2172s1c1
Sequence:CCGGCGTAATACAGTTCCTTGTGTTCTCGAGAACACAAGGAACTGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-1020s1c1
Sequence:CCGGCCCTCTATTGAATCAAAGGTTCTCGAGAACCTTTGATTCAATAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026658
VALIDATED
MTO1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial tRNA translation optimization 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2109s1c1
Sequence:CCGGGCTTGTGAACTTTCATTTCATCTCGAGATGAAATGAAAGTTCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026658.1-407s1c1
Sequence:CCGGCAAAGTGCTAAACCGGCGTAACTCGAGTTACGCCGGTTTAGCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2105s1c1
Sequence:CCGGCGGTGCTTGTGAACTTTCATTCTCGAGAATGAAAGTTCACAAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-2172s1c1
Sequence:CCGGCGTAATACAGTTCCTTGTGTTCTCGAGAACACAAGGAACTGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026658.1-1020s1c1
Sequence:CCGGCCCTCTATTGAATCAAAGGTTCTCGAGAACCTTTGATTCAATAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks