EMAIL THIS PAGE TO A FRIEND

MTRR

5-methyltetrahydrofolate-homocysteine methyltransferase reductase

Synonyms: MSR cblE
UniProtKB ID: Q9UBK8, O60471, Q32MA9, Q7Z4M8
Gene ID:
Human(4552) Summary: Methionine is an essential amino acid required for protein synthesis and one-carbon metabolism. Its synthesis is catalyzed by the enzyme methionine synthase. Methionine synthase eventually becomes inactive due to the oxidation of its cob(I)alamin cofactor. The protein encoded by this gene regenerates a functional methionine synthase via reductive methylation. It is a member of the ferredoxin-NADP(+) reductase (FNR) family of electron transferases. Patients of the cbl-E complementation group of disorders of folate/cobalamin metabolism are defective in reductive activation of methionine synthase. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(210009) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Rat(290947) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Zebrafish(560667) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
dog(478623) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
cow(507991) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
domestic cat(101098359) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
chicken(428502) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
naked mole-rat(101720530) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Domestic Rabbit(100350605) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
domestic guinea pig(100732821) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
sheep(101123409) 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070551 MISSION® esiRNA esiRNA human MTRR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002454 Rosetta Predictions human pricing
NM_024010 Rosetta Predictions human pricing
NM_001039003 Rosetta Predictions rat pricing
NM_172480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090020 predicted 1369
2 SASI_Hs01_00090021 predicted 1086
3 SASI_Hs02_00333858 predicted 2280
4 SASI_Hs01_00090022 predicted 1873
5 SASI_Hs01_00090023 predicted 425
6 SASI_Hs01_00090024 predicted 516
7 SASI_Hs01_00090025 predicted 1490
8 SASI_Hs01_00090026 predicted 1944
9 SASI_Hs01_00090027 predicted 975
10 SASI_Hs01_00090029 predicted 2039
11 SASI_Hs01_00090028 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166148 predicted 1335
2 SASI_Hs01_00166149 predicted 1060
3 SASI_Hs02_00356427 predicted 2261
4 SASI_Hs01_00166150 predicted 1850
5 SASI_Hs01_00166151 predicted 399
6 SASI_Hs01_00166152 predicted 495
7 SASI_Hs01_00166153 predicted 1455
8 SASI_Hs01_00166154 predicted 1917
9 SASI_Hs01_00166155 predicted 943
10 SASI_Hs01_00166157 predicted 2017
11 SASI_Hs01_00166156 predicted 1970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043070 predicted 1071
2 SASI_Rn01_00043071 predicted 231
3 SASI_Rn01_00043072 predicted 345
4 SASI_Rn01_00043073 predicted 1449
5 SASI_Rn01_00043074 predicted 593
6 SASI_Rn01_00043075 predicted 1468
7 SASI_Rn01_00043076 predicted 243
8 SASI_Rn01_00043077 predicted 1600
9 SASI_Rn01_00043078 predicted 1183
10 SASI_Rn01_00043079 predicted 1650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344031 predicted 487
2 SASI_Mm02_00344032 predicted 1834
3 SASI_Mm02_00344033 predicted 1037
4 SASI_Mm02_00344034 predicted 1474
5 SASI_Mm02_00344035 predicted 1769
6 SASI_Mm02_00344036 predicted 936
7 SASI_Mm02_00344037 predicted 945
8 SASI_Mm02_00344038 predicted 1311
9 SASI_Mm02_00344039 predicted 821
10 SASI_Mm02_00344040 predicted 1894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002454
VALIDATED
MTRR MISSION shRNA Bacterial Glycerol Stock
5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002454.2-1478s21c1
Sequence:CCGGACTTCAACCCAGACCATATTCCTCGAGGAATATGGTCTGGGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002454.2-413s21c1
Sequence:CCGGGTTACTGGGTCTCGGTGATTCCTCGAGGAATCACCGAGACCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-285s1c1
Sequence:CCGGCCCGCAAGTTTGTTAAGGAAACTCGAGTTTCCTTAACAAACTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-1310s1c1
Sequence:CCGGGCCGATTATAGCCGCTTTGTACTCGAGTACAAAGCGGCTATAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-1818s1c1
Sequence:CCGGGCAGGCATAAGGATAGGGATTCTCGAGAATCCCTATCCTTATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-549s1c1
Sequence:CCGGGCAGAGGACAAGAGGAGATAACTCGAGTTATCTCCTCTTGTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002454.1-134s1c1
Sequence:CCGGGCAGAAGAAATGTGTGAGCAACTCGAGTTGCTCACACATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002454
VALIDATED
MTRR MISSION shRNA shRNA Plasmid DNA
5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002454.2-1478s21c1
Sequence:CCGGACTTCAACCCAGACCATATTCCTCGAGGAATATGGTCTGGGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002454.2-413s21c1
Sequence:CCGGGTTACTGGGTCTCGGTGATTCCTCGAGGAATCACCGAGACCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-285s1c1
Sequence:CCGGCCCGCAAGTTTGTTAAGGAAACTCGAGTTTCCTTAACAAACTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-1310s1c1
Sequence:CCGGGCCGATTATAGCCGCTTTGTACTCGAGTACAAAGCGGCTATAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-1818s1c1
Sequence:CCGGGCAGGCATAAGGATAGGGATTCTCGAGAATCCCTATCCTTATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-549s1c1
Sequence:CCGGGCAGAGGACAAGAGGAGATAACTCGAGTTATCTCCTCTTGTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002454.1-134s1c1
Sequence:CCGGGCAGAAGAAATGTGTGAGCAACTCGAGTTGCTCACACATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002454
VALIDATED
MTRR MISSION shRNA Lentiviral Transduction Particles
5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002454.2-1478s21c1
Sequence:CCGGACTTCAACCCAGACCATATTCCTCGAGGAATATGGTCTGGGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002454.2-413s21c1
Sequence:CCGGGTTACTGGGTCTCGGTGATTCCTCGAGGAATCACCGAGACCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-285s1c1
Sequence:CCGGCCCGCAAGTTTGTTAAGGAAACTCGAGTTTCCTTAACAAACTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-1310s1c1
Sequence:CCGGGCCGATTATAGCCGCTTTGTACTCGAGTACAAAGCGGCTATAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-1818s1c1
Sequence:CCGGGCAGGCATAAGGATAGGGATTCTCGAGAATCCCTATCCTTATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002454.1-549s1c1
Sequence:CCGGGCAGAGGACAAGAGGAGATAACTCGAGTTATCTCCTCTTGTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002454.1-134s1c1
Sequence:CCGGGCAGAAGAAATGTGTGAGCAACTCGAGTTGCTCACACATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172480
MTRR MISSION shRNA Bacterial Glycerol Stock
5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-1478s21c1
Sequence:CCGGACAAGCTTCACTTCGTGTTTACTCGAGTAAACACGAAGTGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-2072s21c1
Sequence:CCGGACACCCTCATAGGAATCATAACTCGAGTTATGATTCCTATGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172480.2-2518s21c1
Sequence:CCGGAGAGCTTGTGGACATACTATCCTCGAGGATAGTATGTCCACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-939s21c1
Sequence:CCGGGACTACAAATGATGCCGTAAACTCGAGTTTACGGCATCATTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-478s21c1
Sequence:CCGGGCCGATGACTGTGTCGGTTTACTCGAGTAAACCGACACAGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-1318s1c1
Sequence:CCGGCGCTGATTACAACCGCTTCATCTCGAGATGAAGCGGTTGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-300s1c1
Sequence:CCGGCCCGGAAGTTTGTTAAAGAAACTCGAGTTTCTTTAACAAACTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-1492s1c1
Sequence:CCGGCGTGTTTAACATCGTGGAGTTCTCGAGAACTCCACGATGTTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-137s1c1
Sequence:CCGGGCAAAGGCCATAGCAGAAGAACTCGAGTTCTTCTGCTATGGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-2102s1c1
Sequence:CCGGGCTGGTGTTGACAAACTAGAACTCGAGTTCTAGTTTGTCAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172480
MTRR MISSION shRNA shRNA Plasmid DNA
5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-1478s21c1
Sequence:CCGGACAAGCTTCACTTCGTGTTTACTCGAGTAAACACGAAGTGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-2072s21c1
Sequence:CCGGACACCCTCATAGGAATCATAACTCGAGTTATGATTCCTATGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172480.2-2518s21c1
Sequence:CCGGAGAGCTTGTGGACATACTATCCTCGAGGATAGTATGTCCACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-939s21c1
Sequence:CCGGGACTACAAATGATGCCGTAAACTCGAGTTTACGGCATCATTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-478s21c1
Sequence:CCGGGCCGATGACTGTGTCGGTTTACTCGAGTAAACCGACACAGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-1318s1c1
Sequence:CCGGCGCTGATTACAACCGCTTCATCTCGAGATGAAGCGGTTGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-300s1c1
Sequence:CCGGCCCGGAAGTTTGTTAAAGAAACTCGAGTTTCTTTAACAAACTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-1492s1c1
Sequence:CCGGCGTGTTTAACATCGTGGAGTTCTCGAGAACTCCACGATGTTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-137s1c1
Sequence:CCGGGCAAAGGCCATAGCAGAAGAACTCGAGTTCTTCTGCTATGGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-2102s1c1
Sequence:CCGGGCTGGTGTTGACAAACTAGAACTCGAGTTCTAGTTTGTCAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172480
MTRR MISSION shRNA Lentiviral Transduction Particles
5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-1478s21c1
Sequence:CCGGACAAGCTTCACTTCGTGTTTACTCGAGTAAACACGAAGTGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-2072s21c1
Sequence:CCGGACACCCTCATAGGAATCATAACTCGAGTTATGATTCCTATGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172480.2-2518s21c1
Sequence:CCGGAGAGCTTGTGGACATACTATCCTCGAGGATAGTATGTCCACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-939s21c1
Sequence:CCGGGACTACAAATGATGCCGTAAACTCGAGTTTACGGCATCATTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172480.2-478s21c1
Sequence:CCGGGCCGATGACTGTGTCGGTTTACTCGAGTAAACCGACACAGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-1318s1c1
Sequence:CCGGCGCTGATTACAACCGCTTCATCTCGAGATGAAGCGGTTGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-300s1c1
Sequence:CCGGCCCGGAAGTTTGTTAAAGAAACTCGAGTTTCTTTAACAAACTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-1492s1c1
Sequence:CCGGCGTGTTTAACATCGTGGAGTTCTCGAGAACTCCACGATGTTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-137s1c1
Sequence:CCGGGCAAAGGCCATAGCAGAAGAACTCGAGTTCTTCTGCTATGGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172480.1-2102s1c1
Sequence:CCGGGCTGGTGTTGACAAACTAGAACTCGAGTTCTAGTTTGTCAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks