EMAIL THIS PAGE TO A FRIEND

MTX2

metaxin 2

UniProtKB ID: O75431, A8JZZ4, Q53S50, Q53SQ2, Q5M7Z6
Gene ID:
Human(10651) Summary: The protein encoded by this gene is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally associated with the cytosolic face of the outer mitochondrial membrane, and that it is involved in the import of proteins into the mitochondrion. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jun 2009]
Mouse(53375) metaxin 2
Rat(288150) metaxin 2
Zebrafish(286741) metaxin 2
cow(615424) metaxin 2
dog(478811) metaxin 2
chicken(424138) metaxin 2
sheep(101105801) metaxin 2
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006554 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006635 Rosetta Predictions human pricing
NM_006554 Rosetta Predictions human pricing
NM_001008286 Rosetta Predictions rat pricing
NM_016804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228214 predicted 681
2 SASI_Hs01_00228215 predicted 1084
3 SASI_Hs01_00228216 predicted 1088
4 SASI_Hs01_00228217 predicted 1047
5 SASI_Hs01_00228218 predicted 752
6 SASI_Hs01_00228219 predicted 986
7 SASI_Hs01_00228220 predicted 1075
8 SASI_Hs01_00228221 predicted 1220
9 SASI_Hs01_00228222 predicted 1190
10 SASI_Hs01_00228223 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109532 predicted 472
2 SASI_Hs01_00109533 predicted 879
3 SASI_Hs01_00109534 predicted 884
4 SASI_Hs01_00109535 predicted 843
5 SASI_Hs01_00109536 predicted 552
6 SASI_Hs01_00109537 predicted 782
7 SASI_Hs01_00109538 predicted 864
8 SASI_Hs01_00109539 predicted 1019
9 SASI_Hs01_00109540 predicted 989
10 SASI_Hs01_00109541 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198985 predicted 930
2 SASI_Rn01_00050527 predicted 779
3 SASI_Rn02_00198986 predicted 725
4 SASI_Rn01_00050528 predicted 585
5 SASI_Rn01_00050529 predicted 488
6 SASI_Rn01_00050530 predicted 398
7 SASI_Rn02_00198987 predicted 806
8 SASI_Rn01_00050531 predicted 418
9 SASI_Rn01_00050532 predicted 938
10 SASI_Rn01_00050533 predicted 382
11 SASI_Rn01_00050526 predicted 655
12 SASI_Rn01_00050534 predicted 900
13 SASI_Rn01_00050535 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053550 predicted 637
2 SASI_Mm01_00053551 predicted 478
3 SASI_Mm01_00053552 predicted 489
4 SASI_Mm01_00053553 predicted 622
5 SASI_Mm01_00053554 predicted 494
6 SASI_Mm01_00053555 predicted 578
7 SASI_Mm01_00053556 predicted 625
8 SASI_Mm01_00053558 predicted 522
9 SASI_Mm01_00053559 predicted 332
10 SASI_Mm02_00323592 predicted 394
11 SASI_Mm01_00053557 predicted 410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006554
VALIDATED
MTX2 MISSION shRNA Bacterial Glycerol Stock
metaxin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006554.1-858s1c1
Sequence:CCGGGCCATCTATACACCATTCTTACTCGAGTAAGAATGGTGTATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006554.1-373s1c1
Sequence:CCGGCAAAGTAGTTTGTAGGGCAAACTCGAGTTTGCCCTACAAACTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006554.1-703s1c1
Sequence:CCGGCAAACGTAAGATGAAAGCTATCTCGAGATAGCTTTCATCTTACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006554.1-434s1c1
Sequence:CCGGCATGTGGGAAATCAAGTAGTACTCGAGTACTACTTGATTTCCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006554.1-947s1c1
Sequence:CCGGAGGAGAATTGAACAGCACTATCTCGAGATAGTGCTGTTCAATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-449s21c1
Sequence:GTACCGGTGTGGGAAATCAAGTAGTATCCTCGAGGATACTACTTGATTTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-1021s21c1
Sequence:CCGGTGTTAGTCTCAGGAGTCTTAACTCGAGTTAAGACTCCTGAGACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-860s21c1
Sequence:CCGGACTGGTATTTGGCCATCTATACTCGAGTATAGATGGCCAAATACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-808s21c1
Sequence:CCGGGACTGGGAACACAACCGTATTCTCGAGAATACGGTTGTGTTCCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-398s21c1
Sequence:CCGGTAGGGCAAATGCAGAATATATCTCGAGATATATTCTGCATTTGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006554
VALIDATED
MTX2 MISSION shRNA shRNA Plasmid DNA
metaxin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006554.1-858s1c1
Sequence:CCGGGCCATCTATACACCATTCTTACTCGAGTAAGAATGGTGTATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006554.1-373s1c1
Sequence:CCGGCAAAGTAGTTTGTAGGGCAAACTCGAGTTTGCCCTACAAACTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006554.1-703s1c1
Sequence:CCGGCAAACGTAAGATGAAAGCTATCTCGAGATAGCTTTCATCTTACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006554.1-434s1c1
Sequence:CCGGCATGTGGGAAATCAAGTAGTACTCGAGTACTACTTGATTTCCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006554.1-947s1c1
Sequence:CCGGAGGAGAATTGAACAGCACTATCTCGAGATAGTGCTGTTCAATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-449s21c1
Sequence:GTACCGGTGTGGGAAATCAAGTAGTATCCTCGAGGATACTACTTGATTTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-1021s21c1
Sequence:CCGGTGTTAGTCTCAGGAGTCTTAACTCGAGTTAAGACTCCTGAGACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-860s21c1
Sequence:CCGGACTGGTATTTGGCCATCTATACTCGAGTATAGATGGCCAAATACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-808s21c1
Sequence:CCGGGACTGGGAACACAACCGTATTCTCGAGAATACGGTTGTGTTCCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-398s21c1
Sequence:CCGGTAGGGCAAATGCAGAATATATCTCGAGATATATTCTGCATTTGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006554
VALIDATED
MTX2 MISSION shRNA Lentiviral Transduction Particles
metaxin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006554.1-858s1c1
Sequence:CCGGGCCATCTATACACCATTCTTACTCGAGTAAGAATGGTGTATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006554.1-373s1c1
Sequence:CCGGCAAAGTAGTTTGTAGGGCAAACTCGAGTTTGCCCTACAAACTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006554.1-703s1c1
Sequence:CCGGCAAACGTAAGATGAAAGCTATCTCGAGATAGCTTTCATCTTACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006554.1-434s1c1
Sequence:CCGGCATGTGGGAAATCAAGTAGTACTCGAGTACTACTTGATTTCCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006554.1-947s1c1
Sequence:CCGGAGGAGAATTGAACAGCACTATCTCGAGATAGTGCTGTTCAATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-449s21c1
Sequence:GTACCGGTGTGGGAAATCAAGTAGTATCCTCGAGGATACTACTTGATTTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-1021s21c1
Sequence:CCGGTGTTAGTCTCAGGAGTCTTAACTCGAGTTAAGACTCCTGAGACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-860s21c1
Sequence:CCGGACTGGTATTTGGCCATCTATACTCGAGTATAGATGGCCAAATACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-808s21c1
Sequence:CCGGGACTGGGAACACAACCGTATTCTCGAGAATACGGTTGTGTTCCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006554.3-398s21c1
Sequence:CCGGTAGGGCAAATGCAGAATATATCTCGAGATATATTCTGCATTTGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016804
VALIDATED
MTX2 MISSION shRNA Bacterial Glycerol Stock
metaxin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016804.2-1456s1c1
Sequence:CCGGGCTGGGATGAAAGAACTGTTTCTCGAGAAACAGTTCTTTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-689s1c1
Sequence:CCGGCTGGACCAGGTCTTAGAAGATCTCGAGATCTTCTAAGACCTGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-411s1c1
Sequence:CCGGGCCCAATAGTCCAATTTGTTACTCGAGTAACAAATTGGACTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-569s1c1
Sequence:CCGGGAGATCACTATTGCTAGGTATCTCGAGATACCTAGCAATAGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-649s1c1
Sequence:CCGGGAAACGTAAGATGAAAGCTATCTCGAGATAGCTTTCATCTTACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-368s21c1
Sequence:CCGGGTAGGGCAAATGCGGAATATACTCGAGTATATTCCGCATTTGCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-449s21c1
Sequence:CCGGGCCCAATAGTCCAATTTGTTACTCGAGTAACAAATTGGACTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-607s21c1
Sequence:CCGGGAGATCACTATTGCTAGGTATCTCGAGATACCTAGCAATAGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016804.4-1038s21c1
Sequence:CCGGTACTTGAACAATATGGTAGTACTCGAGTACTACCATATTGTTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-974s21c1
Sequence:CCGGGGTTGTCTTAGAGCCATATACCTCGAGGTATATGGCTCTAAGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016804
VALIDATED
MTX2 MISSION shRNA shRNA Plasmid DNA
metaxin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016804.2-1456s1c1
Sequence:CCGGGCTGGGATGAAAGAACTGTTTCTCGAGAAACAGTTCTTTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-689s1c1
Sequence:CCGGCTGGACCAGGTCTTAGAAGATCTCGAGATCTTCTAAGACCTGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-411s1c1
Sequence:CCGGGCCCAATAGTCCAATTTGTTACTCGAGTAACAAATTGGACTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-569s1c1
Sequence:CCGGGAGATCACTATTGCTAGGTATCTCGAGATACCTAGCAATAGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-649s1c1
Sequence:CCGGGAAACGTAAGATGAAAGCTATCTCGAGATAGCTTTCATCTTACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-368s21c1
Sequence:CCGGGTAGGGCAAATGCGGAATATACTCGAGTATATTCCGCATTTGCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-449s21c1
Sequence:CCGGGCCCAATAGTCCAATTTGTTACTCGAGTAACAAATTGGACTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-607s21c1
Sequence:CCGGGAGATCACTATTGCTAGGTATCTCGAGATACCTAGCAATAGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016804.4-1038s21c1
Sequence:CCGGTACTTGAACAATATGGTAGTACTCGAGTACTACCATATTGTTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-974s21c1
Sequence:CCGGGGTTGTCTTAGAGCCATATACCTCGAGGTATATGGCTCTAAGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016804
VALIDATED
MTX2 MISSION shRNA Lentiviral Transduction Particles
metaxin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016804.2-1456s1c1
Sequence:CCGGGCTGGGATGAAAGAACTGTTTCTCGAGAAACAGTTCTTTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-689s1c1
Sequence:CCGGCTGGACCAGGTCTTAGAAGATCTCGAGATCTTCTAAGACCTGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-411s1c1
Sequence:CCGGGCCCAATAGTCCAATTTGTTACTCGAGTAACAAATTGGACTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-569s1c1
Sequence:CCGGGAGATCACTATTGCTAGGTATCTCGAGATACCTAGCAATAGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016804.2-649s1c1
Sequence:CCGGGAAACGTAAGATGAAAGCTATCTCGAGATAGCTTTCATCTTACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-368s21c1
Sequence:CCGGGTAGGGCAAATGCGGAATATACTCGAGTATATTCCGCATTTGCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-449s21c1
Sequence:CCGGGCCCAATAGTCCAATTTGTTACTCGAGTAACAAATTGGACTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-607s21c1
Sequence:CCGGGAGATCACTATTGCTAGGTATCTCGAGATACCTAGCAATAGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016804.4-1038s21c1
Sequence:CCGGTACTTGAACAATATGGTAGTACTCGAGTACTACCATATTGTTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016804.4-974s21c1
Sequence:CCGGGGTTGTCTTAGAGCCATATACCTCGAGGTATATGGCTCTAAGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks