EMAIL THIS PAGE TO A FRIEND

MUC16

mucin 16, cell surface associated

Synonyms: CA125
UniProtKB ID: Q8WXI7, Q6ZQW5, Q96RK2
Gene ID:
Mouse(73732) mucin 16
Rat(315451) mucin 16, cell surface associated
naked mole-rat(101704186) mucin 16, cell surface associated
chicken(769718) mucin 16, cell surface associated
cow(786607) mucin 16, cell surface associated
domestic cat(101082044) mucin 16, cell surface associated
dog(476718) mucin 16, cell surface associated
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024690 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024690 Rosetta Predictions human pricing
XM_235886 Rosetta Predictions rat pricing
XM_001476091 Rosetta Predictions mouse pricing
XM_911929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067255 predicted 19407
2 SASI_Hs01_00067256 predicted 3781
3 SASI_Hs01_00067257 predicted 3045
4 SASI_Hs02_00357137 predicted 34294
5 SASI_Hs02_00357138 predicted 18348
6 SASI_Hs02_00357139 predicted 42318
7 SASI_Hs01_00067260 predicted 3105
8 SASI_Hs01_00067261 predicted 4136
9 SASI_Hs02_00357140 predicted 33034
10 SASI_Hs01_00067262 predicted 8207
11 SASI_Hs01_00067258 predicted 7348
12 SASI_Hs01_00067259 predicted 7593
13 SASI_Hs01_00067263 predicted 19249
14 SASI_Hs01_00067264 predicted 8464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389726 predicted 23197
2 SASI_Rn02_00389727 predicted 5943
3 SASI_Rn02_00389728 predicted 5061
4 SASI_Rn02_00389729 predicted 12320
5 SASI_Rn02_00389730 predicted 8740
6 SASI_Rn02_00389731 predicted 848
7 SASI_Rn02_00389732 predicted 16180
8 SASI_Rn02_00389733 predicted 15784
9 SASI_Rn02_00389734 predicted 6502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00386917 predicted 9302
2 SASI_Mm02_00386918 predicted 20085
3 SASI_Mm02_00386919 predicted 6775
4 SASI_Mm02_00386920 predicted 717
5 SASI_Mm02_00386921 predicted 21973
6 SASI_Mm02_00386922 predicted 525
7 SASI_Mm02_00386923 predicted 10128
8 SASI_Mm02_00386924 predicted 20475
9 SASI_Mm02_00386925 predicted 12291
10 SASI_Mm02_00386926 predicted 6391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274253 predicted 9297
2 SASI_Mm01_00274254 predicted 20090
3 SASI_Mm01_00274257 predicted 6770
4 SASI_Mm02_00436713 predicted 712
5 SASI_Mm01_00274259 predicted 21967
6 SASI_Mm02_00436714 predicted 525
7 SASI_Mm01_00274261 predicted 20478
8 SASI_Mm01_00274262 predicted 12293
9 SASI_Mm02_00436715 predicted 6392
10 SASI_Mm02_00436716 predicted 18672
11 SASI_Mm01_00274255 predicted 17708
12 SASI_Mm01_00274256 predicted 18160
13 SASI_Mm01_00274258 predicted 9527
14 SASI_Mm01_00274260 predicted 10129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024690
MUC16 MISSION shRNA Bacterial Glycerol Stock
mucin 16, cell surface associated
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-23539s21c1
Sequence:CCGGACCACCAGCTCTGGATATAAACTCGAGTTTATATCCAGAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-24452s21c1
Sequence:CCGGTCACATCTCCAATGGTTATTACTCGAGTAATAACCATTGGAGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-19164s21c1
Sequence:CCGGACCTGACTCAGACCCATATAACTCGAGTTATATGGGTCTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-3055s21c1
Sequence:CCGGACCAATAGAGACACGTTTAATCTCGAGATTAAACGTGTCTCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-39236s21c1
Sequence:CCGGTGCCGTTCACCCTCAACTTTACTCGAGTAAAGTTGAGGGTGAACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024690.2-1348s1c1
Sequence:CCGGGCCAAGACTTTGGCTTCAGAACTCGAGTTCTGAAGCCAAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024690.2-42923s1c1
Sequence:CCGGGCAGTCAACTACATGACACATCTCGAGATGTGTCATGTAGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024690
MUC16 MISSION shRNA shRNA Plasmid DNA
mucin 16, cell surface associated
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-23539s21c1
Sequence:CCGGACCACCAGCTCTGGATATAAACTCGAGTTTATATCCAGAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-24452s21c1
Sequence:CCGGTCACATCTCCAATGGTTATTACTCGAGTAATAACCATTGGAGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-19164s21c1
Sequence:CCGGACCTGACTCAGACCCATATAACTCGAGTTATATGGGTCTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-3055s21c1
Sequence:CCGGACCAATAGAGACACGTTTAATCTCGAGATTAAACGTGTCTCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-39236s21c1
Sequence:CCGGTGCCGTTCACCCTCAACTTTACTCGAGTAAAGTTGAGGGTGAACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024690.2-1348s1c1
Sequence:CCGGGCCAAGACTTTGGCTTCAGAACTCGAGTTCTGAAGCCAAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024690.2-42923s1c1
Sequence:CCGGGCAGTCAACTACATGACACATCTCGAGATGTGTCATGTAGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024690
MUC16 MISSION shRNA Lentiviral Transduction Particles
mucin 16, cell surface associated
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-23539s21c1
Sequence:CCGGACCACCAGCTCTGGATATAAACTCGAGTTTATATCCAGAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-24452s21c1
Sequence:CCGGTCACATCTCCAATGGTTATTACTCGAGTAATAACCATTGGAGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-19164s21c1
Sequence:CCGGACCTGACTCAGACCCATATAACTCGAGTTATATGGGTCTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-3055s21c1
Sequence:CCGGACCAATAGAGACACGTTTAATCTCGAGATTAAACGTGTCTCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024690.2-39236s21c1
Sequence:CCGGTGCCGTTCACCCTCAACTTTACTCGAGTAAAGTTGAGGGTGAACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024690.2-1348s1c1
Sequence:CCGGGCCAAGACTTTGGCTTCAGAACTCGAGTTCTGAAGCCAAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024690.2-42923s1c1
Sequence:CCGGGCAGTCAACTACATGACACATCTCGAGATGTGTCATGTAGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks