EMAIL THIS PAGE TO A FRIEND

MUC5B

mucin 5B, oligomeric mucus/gel-forming

Synonyms: MG1 MUC-5B MUC5 MUC9
Gene ID:
Human(727897) Summary: This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
Mouse(74180) mucin 5, subtype B, tracheobronchial
Rat(309114) mucin 5B, oligomeric mucus/gel-forming
naked mole-rat(101720090) mucin 5B, oligomeric mucus/gel-forming
domestic guinea pig(100718523) mucin 5B, oligomeric mucus/gel-forming
Zebrafish(100332926) mucin 5B, oligomeric mucus/gel-forming
domestic cat(101096354) mucin 5B, oligomeric mucus/gel-forming
dog(483656) mucin 5B, oligomeric mucus/gel-forming
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155421 MISSION® esiRNA esiRNA human MUC5B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002458 Rosetta Predictions human pricing
XM_001719349 Rosetta Predictions human pricing
XM_001063609 Rosetta Predictions rat pricing
XM_238988 Rosetta Predictions rat pricing
NM_028801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333879 predicted 17396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00429740 predicted 11011
2 SASI_Hs02_00429741 predicted 5675
3 SASI_Hs02_00429742 predicted 3836
4 SASI_Hs02_00429743 predicted 13792
5 SASI_Hs02_00429744 predicted 2756
6 SASI_Hs02_00429745 predicted 13886
7 SASI_Hs02_00429746 predicted 338
8 SASI_Hs02_00429747 predicted 3139
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307798 predicted 11665
2 SASI_Rn02_00307799 predicted 5760
3 SASI_Rn02_00307800 predicted 404
4 SASI_Rn02_00307801 predicted 3717
5 SASI_Rn02_00307802 predicted 2768
6 SASI_Rn02_00307803 predicted 7433
7 SASI_Rn02_00307804 predicted 6203
8 SASI_Rn02_00307805 predicted 6944
9 SASI_Rn02_00307806 predicted 6499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391476 predicted 5762
2 SASI_Rn02_00391477 predicted 401
3 SASI_Rn02_00391478 predicted 3720
4 SASI_Rn02_00391479 predicted 2764
5 SASI_Rn02_00391480 predicted 7432
6 SASI_Rn02_00391481 predicted 6198
7 SASI_Rn02_00391482 predicted 6950
8 SASI_Rn02_00391483 predicted 6497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177884 predicted 9366
2 SASI_Mm01_00177885 predicted 8014
3 SASI_Mm01_00177886 predicted 10797
4 SASI_Mm01_00177887 predicted 12669
5 SASI_Mm01_00177888 predicted 1490
6 SASI_Mm02_00334408 predicted 2654
7 SASI_Mm01_00177889 predicted 11156
8 SASI_Mm01_00177890 predicted 11558
9 SASI_Mm01_00177891 predicted 6664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002458
MUC5B MISSION shRNA Bacterial Glycerol Stock
mucin 5B, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002458.1-15269s21c1
Sequence:CCGGCACTATGAGTGCGAGTGCATCCTCGAGGATGCACTCGCACTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17403s21c1
Sequence:CCGGTGTGCATTGTCTGATCATGAACTCGAGTTCATGATCAGACAATGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002458.1-8192s21c1
Sequence:CCGGACTCCAGGGACAACACCTATCCTCGAGGATAGGTGTTGTCCCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17630s21c1
Sequence:CCGGCCCTGGAACAAACTAAGCATGCTCGAGCATGCTTAGTTTGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17392s21c1
Sequence:CCGGTGGAGCCAGGATGTGCATTGTCTCGAGACAATGCACATCCTGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002458
MUC5B MISSION shRNA shRNA Plasmid DNA
mucin 5B, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002458.1-15269s21c1
Sequence:CCGGCACTATGAGTGCGAGTGCATCCTCGAGGATGCACTCGCACTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17403s21c1
Sequence:CCGGTGTGCATTGTCTGATCATGAACTCGAGTTCATGATCAGACAATGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002458.1-8192s21c1
Sequence:CCGGACTCCAGGGACAACACCTATCCTCGAGGATAGGTGTTGTCCCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17630s21c1
Sequence:CCGGCCCTGGAACAAACTAAGCATGCTCGAGCATGCTTAGTTTGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17392s21c1
Sequence:CCGGTGGAGCCAGGATGTGCATTGTCTCGAGACAATGCACATCCTGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002458
MUC5B MISSION shRNA Lentiviral Transduction Particles
mucin 5B, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002458.1-15269s21c1
Sequence:CCGGCACTATGAGTGCGAGTGCATCCTCGAGGATGCACTCGCACTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17403s21c1
Sequence:CCGGTGTGCATTGTCTGATCATGAACTCGAGTTCATGATCAGACAATGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002458.1-8192s21c1
Sequence:CCGGACTCCAGGGACAACACCTATCCTCGAGGATAGGTGTTGTCCCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17630s21c1
Sequence:CCGGCCCTGGAACAAACTAAGCATGCTCGAGCATGCTTAGTTTGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002458.1-17392s21c1
Sequence:CCGGTGGAGCCAGGATGTGCATTGTCTCGAGACAATGCACATCCTGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028801
MUC5B MISSION shRNA Bacterial Glycerol Stock
mucin 5B, oligomeric mucus/gel-forming
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028801.1-14398s1c1
Sequence:CCGGGCCCATTGCTAGAAGGCAATTCTCGAGAATTGCCTTCTAGCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-4429s1c1
Sequence:CCGGCGCCTACACTTACCACTCATACTCGAGTATGAGTGGTAAGTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-3005s1c1
Sequence:CCGGCCCTCCATACAAGATCAGATTCTCGAGAATCTGATCTTGTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-10854s1c1
Sequence:CCGGCCCAAGTGTAAGTGGACTGAACTCGAGTTCAGTCCACTTACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-10799s1c1
Sequence:CCGGCCTACCAGTAACTGTGACTAACTCGAGTTAGTCACAGTTACTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028801
MUC5B MISSION shRNA shRNA Plasmid DNA
mucin 5B, oligomeric mucus/gel-forming
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028801.1-14398s1c1
Sequence:CCGGGCCCATTGCTAGAAGGCAATTCTCGAGAATTGCCTTCTAGCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-4429s1c1
Sequence:CCGGCGCCTACACTTACCACTCATACTCGAGTATGAGTGGTAAGTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-3005s1c1
Sequence:CCGGCCCTCCATACAAGATCAGATTCTCGAGAATCTGATCTTGTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-10854s1c1
Sequence:CCGGCCCAAGTGTAAGTGGACTGAACTCGAGTTCAGTCCACTTACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-10799s1c1
Sequence:CCGGCCTACCAGTAACTGTGACTAACTCGAGTTAGTCACAGTTACTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028801
MUC5B MISSION shRNA Lentiviral Transduction Particles
mucin 5B, oligomeric mucus/gel-forming
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028801.1-14398s1c1
Sequence:CCGGGCCCATTGCTAGAAGGCAATTCTCGAGAATTGCCTTCTAGCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-4429s1c1
Sequence:CCGGCGCCTACACTTACCACTCATACTCGAGTATGAGTGGTAAGTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-3005s1c1
Sequence:CCGGCCCTCCATACAAGATCAGATTCTCGAGAATCTGATCTTGTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-10854s1c1
Sequence:CCGGCCCAAGTGTAAGTGGACTGAACTCGAGTTCAGTCCACTTACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028801.1-10799s1c1
Sequence:CCGGCCTACCAGTAACTGTGACTAACTCGAGTTAGTCACAGTTACTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks