EMAIL THIS PAGE TO A FRIEND

MURC

muscle-related coiled-coil protein

Synonyms: CAVIN4 cavin-4
UniProtKB ID: Q5BKX8, B1PRL3, B4DT88
Gene ID:
Human(347273) Summary: This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]
Mouse(68016) muscle-related coiled-coil protein
Rat(313225) muscle-related coiled-coil protein
chicken(420986) muscle-related coiled-coil protein
dog(481632) muscle-related coiled-coil protein
domestic cat(101086012) muscle-related coiled-coil protein
cow(528386) muscle-related coiled-coil protein
sheep(101122919) muscle-related coiled-coil protein
domestic guinea pig(100719140) muscle-related coiled-coil protein
naked mole-rat(101710414) muscle-related coiled-coil protein
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001018116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001018116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001018116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018116 Rosetta Predictions human pricing
NM_001107931 Rosetta Predictions rat pricing
NM_026509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210400 predicted 378
2 SASI_Hs01_00210401 predicted 321
3 SASI_Hs02_00307035 predicted 319
4 SASI_Hs01_00210403 predicted 509
5 SASI_Hs01_00210404 predicted 209
6 SASI_Hs01_00210405 predicted 470
7 SASI_Hs02_00307036 predicted 508
8 SASI_Hs01_00210406 predicted 536
9 SASI_Hs01_00210407 predicted 297
10 SASI_Hs01_00210408 predicted 318
11 SASI_Hs01_00210399 predicted 235
12 SASI_Hs01_00210402 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233695 predicted 230
2 SASI_Rn02_00233696 predicted 542
3 SASI_Rn02_00233697 predicted 612
4 SASI_Rn02_00233698 predicted 374
5 SASI_Rn02_00233699 predicted 349
6 SASI_Rn02_00233700 predicted 565
7 SASI_Rn02_00233701 predicted 664
8 SASI_Rn02_00233702 predicted 497
9 SASI_Rn02_00233703 predicted 426
10 SASI_Rn02_00233704 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158850 predicted 1192
2 SASI_Mm01_00158851 predicted 250
3 SASI_Mm01_00158852 predicted 1172
4 SASI_Mm01_00158853 predicted 417
5 SASI_Mm01_00158854 predicted 1127
6 SASI_Mm01_00158855 predicted 1143
7 SASI_Mm01_00158856 predicted 379
8 SASI_Mm02_00330415 predicted 1296
9 SASI_Mm01_00158857 predicted 294
10 SASI_Mm01_00158859 predicted 1192
11 SASI_Mm01_00158858 predicted 1177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026509
MURC MISSION shRNA Bacterial Glycerol Stock
muscle-related coiled-coil protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-388s21c1
Sequence:CCGGGAAGCAACAGGTTCGTGTAACCTCGAGGTTACACGAACCTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-576s21c1
Sequence:CCGGCCTCGGATGAGGAGTATTATGCTCGAGCATAATACTCCTCATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-1142s21c1
Sequence:CCGGCAGTCCTCATAGAGGATTTAACTCGAGTTAAATCCTCTATGAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026509.2-1573s21c1
Sequence:CCGGCTGATGAGTACATCGTGTTATCTCGAGATAACACGATGTACTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026509.2-1701s1c1
Sequence:CCGGGCTGCGGCAACATAACTTTATCTCGAGATAAAGTTATGTTGCCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-979s21c1
Sequence:GTACCGGTGAGTTCCACTCTGATGATTTCTCGAGAAATCATCAGAGTGGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-492s1c1
Sequence:CCGGGCATCCCTGTCTGTTGTTAAACTCGAGTTTAACAACAGACAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-356s1c1
Sequence:CCGGCGCTCACATTAAGGATGTCAACTCGAGTTGACATCCTTAATGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-416s1c1
Sequence:CCGGCGAAACCAAGCAAGAAGAAATCTCGAGATTTCTTCTTGCTTGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-648s1c1
Sequence:CCGGGACCACATCAAGAAAGCCTTTCTCGAGAAAGGCTTTCTTGATGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026509.1-1747s1c1
Sequence:CCGGCCACATATTCTCAATGCTAAACTCGAGTTTAGCATTGAGAATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026509.1-582s1c1
Sequence:CCGGGATGAGGAGTATTATGTTGAACTCGAGTTCAACATAATACTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026509
MURC MISSION shRNA shRNA Plasmid DNA
muscle-related coiled-coil protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-388s21c1
Sequence:CCGGGAAGCAACAGGTTCGTGTAACCTCGAGGTTACACGAACCTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-576s21c1
Sequence:CCGGCCTCGGATGAGGAGTATTATGCTCGAGCATAATACTCCTCATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-1142s21c1
Sequence:CCGGCAGTCCTCATAGAGGATTTAACTCGAGTTAAATCCTCTATGAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026509.2-1573s21c1
Sequence:CCGGCTGATGAGTACATCGTGTTATCTCGAGATAACACGATGTACTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026509.2-1701s1c1
Sequence:CCGGGCTGCGGCAACATAACTTTATCTCGAGATAAAGTTATGTTGCCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-979s21c1
Sequence:GTACCGGTGAGTTCCACTCTGATGATTTCTCGAGAAATCATCAGAGTGGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-492s1c1
Sequence:CCGGGCATCCCTGTCTGTTGTTAAACTCGAGTTTAACAACAGACAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-356s1c1
Sequence:CCGGCGCTCACATTAAGGATGTCAACTCGAGTTGACATCCTTAATGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-416s1c1
Sequence:CCGGCGAAACCAAGCAAGAAGAAATCTCGAGATTTCTTCTTGCTTGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-648s1c1
Sequence:CCGGGACCACATCAAGAAAGCCTTTCTCGAGAAAGGCTTTCTTGATGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026509.1-1747s1c1
Sequence:CCGGCCACATATTCTCAATGCTAAACTCGAGTTTAGCATTGAGAATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026509.1-582s1c1
Sequence:CCGGGATGAGGAGTATTATGTTGAACTCGAGTTCAACATAATACTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026509
MURC MISSION shRNA Lentiviral Transduction Particles
muscle-related coiled-coil protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-388s21c1
Sequence:CCGGGAAGCAACAGGTTCGTGTAACCTCGAGGTTACACGAACCTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-576s21c1
Sequence:CCGGCCTCGGATGAGGAGTATTATGCTCGAGCATAATACTCCTCATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-1142s21c1
Sequence:CCGGCAGTCCTCATAGAGGATTTAACTCGAGTTAAATCCTCTATGAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026509.2-1573s21c1
Sequence:CCGGCTGATGAGTACATCGTGTTATCTCGAGATAACACGATGTACTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026509.2-1701s1c1
Sequence:CCGGGCTGCGGCAACATAACTTTATCTCGAGATAAAGTTATGTTGCCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026509.2-979s21c1
Sequence:GTACCGGTGAGTTCCACTCTGATGATTTCTCGAGAAATCATCAGAGTGGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-492s1c1
Sequence:CCGGGCATCCCTGTCTGTTGTTAAACTCGAGTTTAACAACAGACAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-356s1c1
Sequence:CCGGCGCTCACATTAAGGATGTCAACTCGAGTTGACATCCTTAATGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-416s1c1
Sequence:CCGGCGAAACCAAGCAAGAAGAAATCTCGAGATTTCTTCTTGCTTGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026509.1-648s1c1
Sequence:CCGGGACCACATCAAGAAAGCCTTTCTCGAGAAAGGCTTTCTTGATGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026509.1-1747s1c1
Sequence:CCGGCCACATATTCTCAATGCTAAACTCGAGTTTAGCATTGAGAATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026509.1-582s1c1
Sequence:CCGGGATGAGGAGTATTATGTTGAACTCGAGTTCAACATAATACTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018116
MURC MISSION shRNA Bacterial Glycerol Stock
muscle-related coiled-coil protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-323s1c1
Sequence:CCGGCGCATAGCAATACAGGGCATACTCGAGTATGCCCTGTATTGCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018116.1-2447s1c1
Sequence:CCGGCGAAACCCTGACTCTACTGAACTCGAGTTCAGTAGAGTCAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-516s1c1
Sequence:CCGGGACATCCCTGTCTGTTGTTAACTCGAGTTAACAACAGACAGGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-442s1c1
Sequence:CCGGGAAGTCAAGCAAGAGGAAATACTCGAGTATTTCCTCTTGCTTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-1138s1c1
Sequence:CCGGGTAGAGGATGATGAATCTCTTCTCGAGAAGAGATTCATCATCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-313s1c1
Sequence:CCGGCTTTCACAGTCGCATAGCAATCTCGAGATTGCTATGCGACTGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018116.1-1870s1c1
Sequence:CCGGGCACCAATCAATAAGGTCCTACTCGAGTAGGACCTTATTGATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-235s1c1
Sequence:CCGGGCAAGCCAGAAGAGAATAGAACTCGAGTTCTATTCTCTTCTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-1129s1c1
Sequence:CCGGCAGGTGAAAGTAGAGGATGATCTCGAGATCATCCTCTACTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018116
MURC MISSION shRNA shRNA Plasmid DNA
muscle-related coiled-coil protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-323s1c1
Sequence:CCGGCGCATAGCAATACAGGGCATACTCGAGTATGCCCTGTATTGCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018116.1-2447s1c1
Sequence:CCGGCGAAACCCTGACTCTACTGAACTCGAGTTCAGTAGAGTCAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-516s1c1
Sequence:CCGGGACATCCCTGTCTGTTGTTAACTCGAGTTAACAACAGACAGGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-442s1c1
Sequence:CCGGGAAGTCAAGCAAGAGGAAATACTCGAGTATTTCCTCTTGCTTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-1138s1c1
Sequence:CCGGGTAGAGGATGATGAATCTCTTCTCGAGAAGAGATTCATCATCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-313s1c1
Sequence:CCGGCTTTCACAGTCGCATAGCAATCTCGAGATTGCTATGCGACTGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018116.1-1870s1c1
Sequence:CCGGGCACCAATCAATAAGGTCCTACTCGAGTAGGACCTTATTGATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-235s1c1
Sequence:CCGGGCAAGCCAGAAGAGAATAGAACTCGAGTTCTATTCTCTTCTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-1129s1c1
Sequence:CCGGCAGGTGAAAGTAGAGGATGATCTCGAGATCATCCTCTACTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018116
MURC MISSION shRNA Lentiviral Transduction Particles
muscle-related coiled-coil protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-323s1c1
Sequence:CCGGCGCATAGCAATACAGGGCATACTCGAGTATGCCCTGTATTGCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018116.1-2447s1c1
Sequence:CCGGCGAAACCCTGACTCTACTGAACTCGAGTTCAGTAGAGTCAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-516s1c1
Sequence:CCGGGACATCCCTGTCTGTTGTTAACTCGAGTTAACAACAGACAGGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-442s1c1
Sequence:CCGGGAAGTCAAGCAAGAGGAAATACTCGAGTATTTCCTCTTGCTTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-1138s1c1
Sequence:CCGGGTAGAGGATGATGAATCTCTTCTCGAGAAGAGATTCATCATCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-313s1c1
Sequence:CCGGCTTTCACAGTCGCATAGCAATCTCGAGATTGCTATGCGACTGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018116.1-1870s1c1
Sequence:CCGGGCACCAATCAATAAGGTCCTACTCGAGTAGGACCTTATTGATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018116.1-235s1c1
Sequence:CCGGGCAAGCCAGAAGAGAATAGAACTCGAGTTCTATTCTCTTCTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018116.1-1129s1c1
Sequence:CCGGCAGGTGAAAGTAGAGGATGATCTCGAGATCATCCTCTACTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks