EMAIL THIS PAGE TO A FRIEND

MUT

methylmalonyl CoA mutase

Synonyms: MCM
UniProtKB ID: P22033, A8K953, Q5SYZ3, Q96B11, Q9UD64
Gene ID:
Human(4594) Summary: This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
Mouse(17850) methylmalonyl-Coenzyme A mutase
Rat(688517) methylmalonyl CoA mutase
sheep(101122731) methylmalonyl CoA mutase
naked mole-rat(101726092) methylmalonyl CoA mutase
Domestic Rabbit(100357233) methylmalonyl CoA mutase
Zebrafish(569581) methylmalonyl Coenzyme A mutase
cow(280871) methylmalonyl CoA mutase
Horse(100055925) methylmalonyl CoA mutase
domestic cat(101081046) methylmalonyl CoA mutase
dog(474930) methylmalonyl CoA mutase
chicken(422049) methylmalonyl CoA mutase
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000255 Rosetta Predictions human pricing
XM_001067239 Rosetta Predictions rat pricing
NM_008650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088274 predicted 1634
2 SASI_Hs01_00088275 predicted 1699
3 SASI_Hs01_00088277 predicted 1460
4 SASI_Hs01_00088278 predicted 663
5 SASI_Hs01_00088279 predicted 1098
6 SASI_Hs01_00088280 predicted 1428
7 SASI_Hs02_00302181 predicted 2050
8 SASI_Hs02_00302182 predicted 889
9 SASI_Hs02_00302183 predicted 2375
10 SASI_Hs02_00302184 predicted 868
11 SASI_Hs01_00088276 predicted 1368
12 SASI_Hs01_00088281 predicted 805
13 SASI_Hs01_00088282 predicted 697
14 SASI_Hs01_00088283 predicted 1650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320366 predicted 1599
2 SASI_Rn02_00320367 predicted 526
3 SASI_Rn02_00320368 predicted 1173
4 SASI_Rn02_00320369 predicted 1465
5 SASI_Rn02_00320370 predicted 2555
6 SASI_Rn02_00320371 predicted 1693
7 SASI_Rn02_00320372 predicted 2537
8 SASI_Rn02_00320373 predicted 730
9 SASI_Rn02_00320374 predicted 456
10 SASI_Rn02_00320375 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314396 predicted 1304
2 SASI_Mm01_00170507 predicted 1436
3 SASI_Mm01_00170508 predicted 1009
4 SASI_Mm02_00314397 predicted 2203
5 SASI_Mm01_00170510 predicted 404
6 SASI_Mm01_00170511 predicted 1896
7 SASI_Mm02_00314398 predicted 1021
8 SASI_Mm01_00170512 predicted 294
9 SASI_Mm01_00170515 predicted 2191
10 SASI_Mm02_00314399 predicted 576
11 SASI_Mm01_00170506 predicted 1490
12 SASI_Mm01_00170509 predicted 1829
13 SASI_Mm01_00170513 predicted 1471
14 SASI_Mm01_00170514 predicted 1953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000255
VALIDATED
MUT MISSION shRNA Bacterial Glycerol Stock
methylmalonyl CoA mutase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-2052s21c1
Sequence:CCGGTGCTATCAAGAGGGTTCATAACTCGAGTTATGAACCCTCTTGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-1750s21c1
Sequence:CCGGGCTGTAGAAGTTCTGGCAATTCTCGAGAATTGCCAGAACTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-1672s21c1
Sequence:CCGGGCCCGAAGACAAGCTAGAATACTCGAGTATTCTAGCTTGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-2653s21c1
Sequence:CCGGCCTGGTGTCATGCTATAAGTACTCGAGTACTTATAGCATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-466s21c1
Sequence:CCGGCCCTTGTATTCCAAGAGAGATCTCGAGATCTCTCTTGGAATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-2474s1c1
Sequence:CCGGCCTGGTGTCATGCTATAAGTACTCGAGTACTTATAGCATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-1493s1c1
Sequence:CCGGGCCCGAAGACAAGCTAGAATACTCGAGTATTCTAGCTTGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-1571s1c1
Sequence:CCGGGCTGTAGAAGTTCTGGCAATTCTCGAGAATTGCCAGAACTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-287s1c1
Sequence:CCGGCCCTTGTATTCCAAGAGAGATCTCGAGATCTCTCTTGGAATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000255.1-469s1c1
Sequence:CCGGGCAGGGATTATCAGTTGCCTTCTCGAGAAGGCAACTGATAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000255
VALIDATED
MUT MISSION shRNA shRNA Plasmid DNA
methylmalonyl CoA mutase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-2052s21c1
Sequence:CCGGTGCTATCAAGAGGGTTCATAACTCGAGTTATGAACCCTCTTGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-1750s21c1
Sequence:CCGGGCTGTAGAAGTTCTGGCAATTCTCGAGAATTGCCAGAACTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-1672s21c1
Sequence:CCGGGCCCGAAGACAAGCTAGAATACTCGAGTATTCTAGCTTGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-2653s21c1
Sequence:CCGGCCTGGTGTCATGCTATAAGTACTCGAGTACTTATAGCATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-466s21c1
Sequence:CCGGCCCTTGTATTCCAAGAGAGATCTCGAGATCTCTCTTGGAATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-2474s1c1
Sequence:CCGGCCTGGTGTCATGCTATAAGTACTCGAGTACTTATAGCATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-1493s1c1
Sequence:CCGGGCCCGAAGACAAGCTAGAATACTCGAGTATTCTAGCTTGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-1571s1c1
Sequence:CCGGGCTGTAGAAGTTCTGGCAATTCTCGAGAATTGCCAGAACTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-287s1c1
Sequence:CCGGCCCTTGTATTCCAAGAGAGATCTCGAGATCTCTCTTGGAATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000255.1-469s1c1
Sequence:CCGGGCAGGGATTATCAGTTGCCTTCTCGAGAAGGCAACTGATAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000255
VALIDATED
MUT MISSION shRNA Lentiviral Transduction Particles
methylmalonyl CoA mutase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-2052s21c1
Sequence:CCGGTGCTATCAAGAGGGTTCATAACTCGAGTTATGAACCCTCTTGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-1750s21c1
Sequence:CCGGGCTGTAGAAGTTCTGGCAATTCTCGAGAATTGCCAGAACTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-1672s21c1
Sequence:CCGGGCCCGAAGACAAGCTAGAATACTCGAGTATTCTAGCTTGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-2653s21c1
Sequence:CCGGCCTGGTGTCATGCTATAAGTACTCGAGTACTTATAGCATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000255.2-466s21c1
Sequence:CCGGCCCTTGTATTCCAAGAGAGATCTCGAGATCTCTCTTGGAATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-2474s1c1
Sequence:CCGGCCTGGTGTCATGCTATAAGTACTCGAGTACTTATAGCATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-1493s1c1
Sequence:CCGGGCCCGAAGACAAGCTAGAATACTCGAGTATTCTAGCTTGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-1571s1c1
Sequence:CCGGGCTGTAGAAGTTCTGGCAATTCTCGAGAATTGCCAGAACTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000255.1-287s1c1
Sequence:CCGGCCCTTGTATTCCAAGAGAGATCTCGAGATCTCTCTTGGAATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000255.1-469s1c1
Sequence:CCGGGCAGGGATTATCAGTTGCCTTCTCGAGAAGGCAACTGATAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008650
VALIDATED
MUT MISSION shRNA Bacterial Glycerol Stock
methylmalonyl CoA mutase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.2-973s1c1
Sequence:CCGGGACTCACAATTGATGAATTTGCTCGAGCAAATTCATCAATTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.2-1410s1c1
Sequence:CCGGGCTGCTCTGAAGTTGATATATCTCGAGATATATCAACTTCAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1933s1c1
Sequence:CCGGCAAGGTCATTGCTACAGGATTCTCGAGAATCCTGTAGCAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-2156s1c1
Sequence:CCGGCCACCACAGGATTATGAATTTCTCGAGAAATTCATAATCCTGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1765s1c1
Sequence:CCGGGCATAAAGCTAATGATCGTATCTCGAGATACGATCATTAGCTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1943s1c1
Sequence:CCGGGCTACAGGATTTGCTGATCTTCTCGAGAAGATCAGCAAATCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008650.1-3036s1c1
Sequence:CCGGGCTCCTCACATGGGAATGATACTCGAGTATCATTCCCATGTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.1-238s1c1
Sequence:CCGGGATCTCTATAAAGCCCTTATACTCGAGTATAAGGGCTTTATAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008650
VALIDATED
MUT MISSION shRNA shRNA Plasmid DNA
methylmalonyl CoA mutase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.2-973s1c1
Sequence:CCGGGACTCACAATTGATGAATTTGCTCGAGCAAATTCATCAATTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.2-1410s1c1
Sequence:CCGGGCTGCTCTGAAGTTGATATATCTCGAGATATATCAACTTCAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1933s1c1
Sequence:CCGGCAAGGTCATTGCTACAGGATTCTCGAGAATCCTGTAGCAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-2156s1c1
Sequence:CCGGCCACCACAGGATTATGAATTTCTCGAGAAATTCATAATCCTGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1765s1c1
Sequence:CCGGGCATAAAGCTAATGATCGTATCTCGAGATACGATCATTAGCTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1943s1c1
Sequence:CCGGGCTACAGGATTTGCTGATCTTCTCGAGAAGATCAGCAAATCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008650.1-3036s1c1
Sequence:CCGGGCTCCTCACATGGGAATGATACTCGAGTATCATTCCCATGTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.1-238s1c1
Sequence:CCGGGATCTCTATAAAGCCCTTATACTCGAGTATAAGGGCTTTATAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008650
VALIDATED
MUT MISSION shRNA Lentiviral Transduction Particles
methylmalonyl CoA mutase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.2-973s1c1
Sequence:CCGGGACTCACAATTGATGAATTTGCTCGAGCAAATTCATCAATTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.2-1410s1c1
Sequence:CCGGGCTGCTCTGAAGTTGATATATCTCGAGATATATCAACTTCAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1933s1c1
Sequence:CCGGCAAGGTCATTGCTACAGGATTCTCGAGAATCCTGTAGCAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-2156s1c1
Sequence:CCGGCCACCACAGGATTATGAATTTCTCGAGAAATTCATAATCCTGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1765s1c1
Sequence:CCGGGCATAAAGCTAATGATCGTATCTCGAGATACGATCATTAGCTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008650.1-1943s1c1
Sequence:CCGGGCTACAGGATTTGCTGATCTTCTCGAGAAGATCAGCAAATCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008650.1-3036s1c1
Sequence:CCGGGCTCCTCACATGGGAATGATACTCGAGTATCATTCCCATGTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008650.1-238s1c1
Sequence:CCGGGATCTCTATAAAGCCCTTATACTCGAGTATAAGGGCTTTATAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks