EMAIL THIS PAGE TO A FRIEND

MXD1

MAX dimerization protein 1

Synonyms: BHLHC58 MAD MAD1
UniProtKB ID: Q05195, B2R6V8, B7ZLI6, D6W5G2, Q6FI41
Gene ID:
Human(4084) Summary: This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Mouse(17119) MAX dimerization protein 1
Rat(362391) max dimerization protein 1
Zebrafish(570082) MAX dimerization protein 1
domestic cat(101095166) MAX dimerization protein 1
cow(514626) MAX dimerization protein 1
dog(612631) MAX dimerization protein 1
chicken(426299) MAX dimerization protein 1
sheep(101106754) MAX dimerization protein 1
naked mole-rat(101697362) MAX dimerization protein 1
domestic guinea pig(100726750) MAX dimerization protein 1
268 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002357 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002357 Rosetta Predictions human pricing
XM_001074696 Rosetta Predictions rat pricing
XM_342716 Rosetta Predictions rat pricing
NM_010751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179640 predicted 1170
2 SASI_Hs01_00179641 predicted 513
3 SASI_Hs01_00179642 predicted 962
4 SASI_Hs01_00179643 predicted 1138
5 SASI_Hs01_00179644 predicted 553
6 SASI_Hs01_00179645 predicted 1160
7 SASI_Hs01_00179646 predicted 992
8 SASI_Hs01_00179647 predicted 660
9 SASI_Hs01_00179648 predicted 1066
10 SASI_Hs01_00179649 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347035 predicted 973
2 SASI_Rn02_00347036 predicted 893
3 SASI_Rn02_00347037 predicted 882
4 SASI_Rn02_00347038 predicted 1028
5 SASI_Rn02_00347039 predicted 767
6 SASI_Rn02_00347040 predicted 817
7 SASI_Rn02_00347041 predicted 919
8 SASI_Rn02_00347042 predicted 800
9 SASI_Rn02_00347043 predicted 1021
10 SASI_Rn02_00347044 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394711 predicted 1493
2 SASI_Rn02_00394712 predicted 1559
3 SASI_Rn02_00394713 predicted 1502
4 SASI_Rn02_00394714 predicted 1552
5 SASI_Rn02_00394715 predicted 1498
6 SASI_Rn02_00394716 predicted 1535
7 SASI_Rn02_00394717 predicted 1550
8 SASI_Rn02_00394718 predicted 1552
9 SASI_Rn02_00394719 predicted 1546
10 SASI_Rn02_00394720 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059926 predicted 423
2 SASI_Mm01_00059927 predicted 838
3 SASI_Mm02_00319264 predicted 927
4 SASI_Mm02_00319265 predicted 1053
5 SASI_Mm01_00059929 predicted 366
6 SASI_Mm02_00319266 predicted 1315
7 SASI_Mm02_00319267 predicted 999
8 SASI_Mm02_00319268 predicted 1022
9 SASI_Mm02_00319269 predicted 967
10 SASI_Mm02_00319270 predicted 1036
11 SASI_Mm01_00059928 predicted 842
12 SASI_Mm01_00059930 predicted 310
13 SASI_Mm01_00059931 predicted 611
14 SASI_Mm01_00059932 predicted 274
15 SASI_Mm01_00059933 predicted 476
16 SASI_Mm01_00059934 predicted 207
17 SASI_Mm01_00059935 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002357
VALIDATED
MXD1 MISSION shRNA Bacterial Glycerol Stock
MAX dimerization protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-508s21c1
Sequence:CCGGTGCCACTTGGACCCGAATCAACTCGAGTTGATTCGGGTCCAAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002357.2-1001s21c1
Sequence:CCGGCACAACTCCCTTGCACGTAAACTCGAGTTTACGTGCAAGGGAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-354s21c1
Sequence:CCGGTCCATGTTACCATACAATAACCTCGAGGTTATTGTATGGTAACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-534s21c1
Sequence:CCGGCACACTACGTTGAGTTTATTACTCGAGTAATAAACTCAACGTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002357.2-1147s21c1
Sequence:CCGGGACTATACATTCCAATCAATTCTCGAGAATTGATTGGAATGTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-844s21c1
Sequence:CCGGTCGGCAGTGATGAGGGCTATTCTCGAGAATAGCCCTCATCACTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002357.1-852s1c1
Sequence:CCGGCTGTTGGTTCTGATTAGGTAACTCGAGTTACCTAATCAGAACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002357.1-317s1c1
Sequence:CCGGGCAGATCAACTCACAATGAAACTCGAGTTTCATTGTGAGTTGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002357.1-755s1c1
Sequence:CCGGGCACCAGCATCAAGAGAATAACTCGAGTTATTCTCTTGATGCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002357.1-448s1c1
Sequence:CCGGGCCAAATTGCACATAAAGAAACTCGAGTTTCTTTATGTGCAATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002357.1-238s1c1
Sequence:CCGGGCCTCCATGTTACCATACAATCTCGAGATTGTATGGTAACATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002357
VALIDATED
MXD1 MISSION shRNA shRNA Plasmid DNA
MAX dimerization protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-508s21c1
Sequence:CCGGTGCCACTTGGACCCGAATCAACTCGAGTTGATTCGGGTCCAAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002357.2-1001s21c1
Sequence:CCGGCACAACTCCCTTGCACGTAAACTCGAGTTTACGTGCAAGGGAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-354s21c1
Sequence:CCGGTCCATGTTACCATACAATAACCTCGAGGTTATTGTATGGTAACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-534s21c1
Sequence:CCGGCACACTACGTTGAGTTTATTACTCGAGTAATAAACTCAACGTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002357.2-1147s21c1
Sequence:CCGGGACTATACATTCCAATCAATTCTCGAGAATTGATTGGAATGTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-844s21c1
Sequence:CCGGTCGGCAGTGATGAGGGCTATTCTCGAGAATAGCCCTCATCACTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002357.1-852s1c1
Sequence:CCGGCTGTTGGTTCTGATTAGGTAACTCGAGTTACCTAATCAGAACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002357.1-317s1c1
Sequence:CCGGGCAGATCAACTCACAATGAAACTCGAGTTTCATTGTGAGTTGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002357.1-755s1c1
Sequence:CCGGGCACCAGCATCAAGAGAATAACTCGAGTTATTCTCTTGATGCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002357.1-448s1c1
Sequence:CCGGGCCAAATTGCACATAAAGAAACTCGAGTTTCTTTATGTGCAATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002357.1-238s1c1
Sequence:CCGGGCCTCCATGTTACCATACAATCTCGAGATTGTATGGTAACATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002357
VALIDATED
MXD1 MISSION shRNA Lentiviral Transduction Particles
MAX dimerization protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-508s21c1
Sequence:CCGGTGCCACTTGGACCCGAATCAACTCGAGTTGATTCGGGTCCAAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002357.2-1001s21c1
Sequence:CCGGCACAACTCCCTTGCACGTAAACTCGAGTTTACGTGCAAGGGAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-354s21c1
Sequence:CCGGTCCATGTTACCATACAATAACCTCGAGGTTATTGTATGGTAACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-534s21c1
Sequence:CCGGCACACTACGTTGAGTTTATTACTCGAGTAATAAACTCAACGTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002357.2-1147s21c1
Sequence:CCGGGACTATACATTCCAATCAATTCTCGAGAATTGATTGGAATGTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002357.2-844s21c1
Sequence:CCGGTCGGCAGTGATGAGGGCTATTCTCGAGAATAGCCCTCATCACTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002357.1-852s1c1
Sequence:CCGGCTGTTGGTTCTGATTAGGTAACTCGAGTTACCTAATCAGAACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002357.1-317s1c1
Sequence:CCGGGCAGATCAACTCACAATGAAACTCGAGTTTCATTGTGAGTTGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002357.1-755s1c1
Sequence:CCGGGCACCAGCATCAAGAGAATAACTCGAGTTATTCTCTTGATGCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002357.1-448s1c1
Sequence:CCGGGCCAAATTGCACATAAAGAAACTCGAGTTTCTTTATGTGCAATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002357.1-238s1c1
Sequence:CCGGGCCTCCATGTTACCATACAATCTCGAGATTGTATGGTAACATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010751
VALIDATED
MXD1 MISSION shRNA Bacterial Glycerol Stock
MAX dimerization protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-368s21c1
Sequence:CCGGCTGTGCCTAGAGAAGCTAAAGCTCGAGCTTTAGCTTCTCTAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010751.3-283s21c1
Sequence:CCGGACGGAGGAACAAGCCCAAGAACTCGAGTTCTTGGGCTTGTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010751.3-898s21c1
Sequence:CCGGGCAAACCTCATGTACCACCTTCTCGAGAAGGTGGTACATGAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-239s21c1
Sequence:CCGGTATGCCTCCATGCTGCCATACCTCGAGGTATGGCAGCATGGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-309s21c1
Sequence:CCGGGCACCAGTAGCAGATCAACTCCTCGAGGAGTTGATCTGCTACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-793s1c1
Sequence:CCGGGCAAACCTCATGTACCACCTTCTCGAGAAGGTGGTACATGAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-270s1c1
Sequence:CCGGGCCTAGAGAAGCTAAAGGGATCTCGAGATCCCTTTAGCTTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010751.1-222s1c1
Sequence:CCGGCAACTCACAATGAAATGGAAACTCGAGTTTCCATTTCATTGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-394s1c1
Sequence:CCGGCCACCAAATAGACCAGCTTCACTCGAGTGAAGCTGGTCTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-212s1c1
Sequence:CCGGAGTAGCAGATCAACTCACAATCTCGAGATTGTGAGTTGATCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010751
VALIDATED
MXD1 MISSION shRNA shRNA Plasmid DNA
MAX dimerization protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-368s21c1
Sequence:CCGGCTGTGCCTAGAGAAGCTAAAGCTCGAGCTTTAGCTTCTCTAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010751.3-283s21c1
Sequence:CCGGACGGAGGAACAAGCCCAAGAACTCGAGTTCTTGGGCTTGTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010751.3-898s21c1
Sequence:CCGGGCAAACCTCATGTACCACCTTCTCGAGAAGGTGGTACATGAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-239s21c1
Sequence:CCGGTATGCCTCCATGCTGCCATACCTCGAGGTATGGCAGCATGGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-309s21c1
Sequence:CCGGGCACCAGTAGCAGATCAACTCCTCGAGGAGTTGATCTGCTACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-793s1c1
Sequence:CCGGGCAAACCTCATGTACCACCTTCTCGAGAAGGTGGTACATGAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-270s1c1
Sequence:CCGGGCCTAGAGAAGCTAAAGGGATCTCGAGATCCCTTTAGCTTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010751.1-222s1c1
Sequence:CCGGCAACTCACAATGAAATGGAAACTCGAGTTTCCATTTCATTGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-394s1c1
Sequence:CCGGCCACCAAATAGACCAGCTTCACTCGAGTGAAGCTGGTCTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-212s1c1
Sequence:CCGGAGTAGCAGATCAACTCACAATCTCGAGATTGTGAGTTGATCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010751
VALIDATED
MXD1 MISSION shRNA Lentiviral Transduction Particles
MAX dimerization protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-368s21c1
Sequence:CCGGCTGTGCCTAGAGAAGCTAAAGCTCGAGCTTTAGCTTCTCTAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010751.3-283s21c1
Sequence:CCGGACGGAGGAACAAGCCCAAGAACTCGAGTTCTTGGGCTTGTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010751.3-898s21c1
Sequence:CCGGGCAAACCTCATGTACCACCTTCTCGAGAAGGTGGTACATGAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-239s21c1
Sequence:CCGGTATGCCTCCATGCTGCCATACCTCGAGGTATGGCAGCATGGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010751.3-309s21c1
Sequence:CCGGGCACCAGTAGCAGATCAACTCCTCGAGGAGTTGATCTGCTACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-793s1c1
Sequence:CCGGGCAAACCTCATGTACCACCTTCTCGAGAAGGTGGTACATGAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-270s1c1
Sequence:CCGGGCCTAGAGAAGCTAAAGGGATCTCGAGATCCCTTTAGCTTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010751.1-222s1c1
Sequence:CCGGCAACTCACAATGAAATGGAAACTCGAGTTTCCATTTCATTGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-394s1c1
Sequence:CCGGCCACCAAATAGACCAGCTTCACTCGAGTGAAGCTGGTCTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010751.1-212s1c1
Sequence:CCGGAGTAGCAGATCAACTCACAATCTCGAGATTGTGAGTTGATCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks