EMAIL THIS PAGE TO A FRIEND

MXD3

MAX dimerization protein 3

Synonyms: BHLHC13 MAD3 MYX
UniProtKB ID: Q9BW11, Q53HK1, Q7Z4Y0, Q8NDJ7, Q96ME3
Gene ID:
Human(83463) Summary: This gene encodes a member of the Myc superfamily of basic helix-loop-helix leucine zipper transcriptional regulators. The encoded protein forms a heterodimer with the cofactor MAX which binds specific E-box DNA motifs in the promoters of target genes and regulates their transcription. Disruption of the MAX-MXD3 complex is associated with uncontrolled cell proliferation and tumorigenesis. Transcript variants of this gene encoding different isoforms have been described.[provided by RefSeq, Dec 2008]
Mouse(17121) Max dimerization protein 3
Rat(252915) Max dimerization protein 3
domestic guinea pig(100734830) MAX dimerization protein 3
naked mole-rat(101696667) MAX dimerization protein 3
sheep(101122188) MAX dimerization protein 3
Zebrafish(394031) MAX dimerization protein 3
cow(533359) MAX dimerization protein 3
domestic cat(101087639) MAX dimerization protein 3
dog(489093) MAX dimerization protein 3
chicken(101751218) MAX dimerization protein 3
chicken(427629) MAX dimerization protein 3
chicken(101668426) MAX dimerization protein 3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501645 Anti-MXD3 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1409864 Anti-MXD3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AV39663 Anti-MXD3 antibody produced in rabbit affinity isolated antibody rabbit, horse, bovine, guinea pig, zebrafish, human, mouse, rat, sheep, canine
western blot pricing
AV30089 Anti-MXD3 antibody produced in rabbit IgG fraction of antiserum human, rabbit, bovine, canine, mouse, horse, pig, rat
western blot pricing
HPA070111 Anti-MXD3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031300 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224881 MISSION® esiRNA esiRNA targeting human MXD3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031300 Rosetta Predictions human pricing
NM_145773 Rosetta Predictions rat pricing
NM_016662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178318 predicted 314
2 SASI_Hs01_00178320 predicted 654
3 SASI_Hs01_00178323 predicted 350
4 SASI_Hs01_00178324 predicted 741
5 SASI_Hs01_00178325 predicted 316
6 SASI_Hs01_00178326 predicted 556
7 SASI_Hs02_00358744 predicted 218
8 SASI_Hs02_00358745 predicted 758
9 SASI_Hs01_00178317 predicted 790
10 SASI_Hs01_00178319 predicted 527
11 SASI_Hs01_00178321 predicted 749
12 SASI_Hs01_00178322 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088058 predicted 333
2 SASI_Rn01_00088059 predicted 324
3 SASI_Rn01_00088060 predicted 710
4 SASI_Rn01_00088061 predicted 338
5 SASI_Rn01_00088062 predicted 617
6 SASI_Rn01_00088063 predicted 660
7 SASI_Rn01_00088064 predicted 754
8 SASI_Rn01_00088065 predicted 326
9 SASI_Rn01_00088067 predicted 608
10 SASI_Rn02_00268773 predicted 227
11 SASI_Rn01_00088066 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079790 predicted 696
2 SASI_Mm01_00079791 predicted 318
3 SASI_Mm01_00079792 predicted 322
4 SASI_Mm02_00323268 predicted 837
5 SASI_Mm02_00323269 predicted 943
6 SASI_Mm02_00323270 predicted 844
7 SASI_Mm02_00323271 predicted 939
8 SASI_Mm01_00079795 predicted 316
9 SASI_Mm02_00323272 predicted 944
10 SASI_Mm02_00323273 predicted 845
11 SASI_Mm01_00079789 predicted 750
12 SASI_Mm01_00079793 predicted 321
13 SASI_Mm01_00079794 predicted 758
14 SASI_Mm01_00079796 predicted 543
15 SASI_Mm01_00079797 predicted 615
16 SASI_Mm01_00079798 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031300
VALIDATED
MXD3 MISSION shRNA Bacterial Glycerol Stock
MAX dimerization protein 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-125s1c1
Sequence:CCGGCGAGCATGGTTATGCGTCCCTCTCGAGAGGGACGCATAACCATGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031300.2-570s1c1
Sequence:CCGGGATGTGGAGAGCCTGGTGTTTCTCGAGAAACACCAGGCTCTCCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-111s1c1
Sequence:CCGGCGTGAGAGAGAGGCCGAGCATCTCGAGATGCTCGGCCTCTCTCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031300.2-227s1c1
Sequence:CCGGGTCAGTGCACAATGAACTGGACTCGAGTCCAGTTCATTGTGCACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-536s1c1
Sequence:CCGGGCGCTCAGACTCAGACCAAGACTCGAGTCTTGGTCTGAGTCTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031300.3-1200s21c1
Sequence:CCGGGACCCTTGTGTGGGAACAGGTCTCGAGACCTGTTCCCACACAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-776s21c1
Sequence:CCGGCATCCAGAAGCTGGAGGATCACTCGAGTGATCCTCCAGCTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-579s21c1
Sequence:CCGGCCCATCCACAGGAGGAAGAAGCTCGAGCTTCTTCCTCCTGTGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-649s21c1
Sequence:CCGGATGAACTGGAGAAGCGCAGGACTCGAGTCCTGCGCTTCTCCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-965s21c1
Sequence:CCGGAGAGGAGCTGGAGGTGGATGTCTCGAGACATCCACCTCCAGCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031300.3-1277s21c1
Sequence:CCGGAGGACTCATCAGGACCTCCCTCTCGAGAGGGAGGTCCTGATGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-509s21c1
Sequence:CCGGGTTCCTGGAGCGCCGTGAGAGCTCGAGCTCTCACGGCGCTCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031300
VALIDATED
MXD3 MISSION shRNA shRNA Plasmid DNA
MAX dimerization protein 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-125s1c1
Sequence:CCGGCGAGCATGGTTATGCGTCCCTCTCGAGAGGGACGCATAACCATGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031300.2-570s1c1
Sequence:CCGGGATGTGGAGAGCCTGGTGTTTCTCGAGAAACACCAGGCTCTCCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-111s1c1
Sequence:CCGGCGTGAGAGAGAGGCCGAGCATCTCGAGATGCTCGGCCTCTCTCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031300.2-227s1c1
Sequence:CCGGGTCAGTGCACAATGAACTGGACTCGAGTCCAGTTCATTGTGCACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-536s1c1
Sequence:CCGGGCGCTCAGACTCAGACCAAGACTCGAGTCTTGGTCTGAGTCTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031300.3-1200s21c1
Sequence:CCGGGACCCTTGTGTGGGAACAGGTCTCGAGACCTGTTCCCACACAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-776s21c1
Sequence:CCGGCATCCAGAAGCTGGAGGATCACTCGAGTGATCCTCCAGCTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-579s21c1
Sequence:CCGGCCCATCCACAGGAGGAAGAAGCTCGAGCTTCTTCCTCCTGTGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-649s21c1
Sequence:CCGGATGAACTGGAGAAGCGCAGGACTCGAGTCCTGCGCTTCTCCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-965s21c1
Sequence:CCGGAGAGGAGCTGGAGGTGGATGTCTCGAGACATCCACCTCCAGCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031300.3-1277s21c1
Sequence:CCGGAGGACTCATCAGGACCTCCCTCTCGAGAGGGAGGTCCTGATGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-509s21c1
Sequence:CCGGGTTCCTGGAGCGCCGTGAGAGCTCGAGCTCTCACGGCGCTCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031300
VALIDATED
MXD3 MISSION shRNA Lentiviral Transduction Particles
MAX dimerization protein 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-125s1c1
Sequence:CCGGCGAGCATGGTTATGCGTCCCTCTCGAGAGGGACGCATAACCATGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031300.2-570s1c1
Sequence:CCGGGATGTGGAGAGCCTGGTGTTTCTCGAGAAACACCAGGCTCTCCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-111s1c1
Sequence:CCGGCGTGAGAGAGAGGCCGAGCATCTCGAGATGCTCGGCCTCTCTCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031300.2-227s1c1
Sequence:CCGGGTCAGTGCACAATGAACTGGACTCGAGTCCAGTTCATTGTGCACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031300.2-536s1c1
Sequence:CCGGGCGCTCAGACTCAGACCAAGACTCGAGTCTTGGTCTGAGTCTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031300.3-1200s21c1
Sequence:CCGGGACCCTTGTGTGGGAACAGGTCTCGAGACCTGTTCCCACACAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-776s21c1
Sequence:CCGGCATCCAGAAGCTGGAGGATCACTCGAGTGATCCTCCAGCTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-579s21c1
Sequence:CCGGCCCATCCACAGGAGGAAGAAGCTCGAGCTTCTTCCTCCTGTGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-649s21c1
Sequence:CCGGATGAACTGGAGAAGCGCAGGACTCGAGTCCTGCGCTTCTCCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-965s21c1
Sequence:CCGGAGAGGAGCTGGAGGTGGATGTCTCGAGACATCCACCTCCAGCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031300.3-1277s21c1
Sequence:CCGGAGGACTCATCAGGACCTCCCTCTCGAGAGGGAGGTCCTGATGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031300.3-509s21c1
Sequence:CCGGGTTCCTGGAGCGCCGTGAGAGCTCGAGCTCTCACGGCGCTCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016662
VALIDATED
MXD3 MISSION shRNA Bacterial Glycerol Stock
MAX dimerization protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016662.2-760s1c1
Sequence:CCGGCCACATGTTGAAGAGACTAAACTCGAGTTTAGTCTCTTCAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-556s1c1
Sequence:CCGGTCAGACTCAGACCAAGAGGATCTCGAGATCCTCTTGGTCTGAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-133s1c1
Sequence:CCGGAGAGAGGCAGAGCACGGTTATCTCGAGATAACCGTGCTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-334s1c1
Sequence:CCGGTGTACCCGATACACTACACTACTCGAGTAGTGTAGTGTATCGGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016662.2-335s1c1
Sequence:CCGGGTACCCGATACACTACACTAACTCGAGTTAGTGTAGTGTATCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-553s21c1
Sequence:CCGGTCAGACTCAGACCAAGAGGATCTCGAGATCCTCTTGGTCTGAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-130s21c1
Sequence:CCGGAGAGAGGCAGAGCACGGTTATCTCGAGATAACCGTGCTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-332s21c1
Sequence:CCGGGTACCCGATACACTACACTAACTCGAGTTAGTGTAGTGTATCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016662.4-757s21c1
Sequence:CCGGCCACATGTTGAAGAGACTAAACTCGAGTTTAGTCTCTTCAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016662
VALIDATED
MXD3 MISSION shRNA shRNA Plasmid DNA
MAX dimerization protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016662.2-760s1c1
Sequence:CCGGCCACATGTTGAAGAGACTAAACTCGAGTTTAGTCTCTTCAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-556s1c1
Sequence:CCGGTCAGACTCAGACCAAGAGGATCTCGAGATCCTCTTGGTCTGAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-133s1c1
Sequence:CCGGAGAGAGGCAGAGCACGGTTATCTCGAGATAACCGTGCTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-334s1c1
Sequence:CCGGTGTACCCGATACACTACACTACTCGAGTAGTGTAGTGTATCGGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016662.2-335s1c1
Sequence:CCGGGTACCCGATACACTACACTAACTCGAGTTAGTGTAGTGTATCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-553s21c1
Sequence:CCGGTCAGACTCAGACCAAGAGGATCTCGAGATCCTCTTGGTCTGAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-130s21c1
Sequence:CCGGAGAGAGGCAGAGCACGGTTATCTCGAGATAACCGTGCTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-332s21c1
Sequence:CCGGGTACCCGATACACTACACTAACTCGAGTTAGTGTAGTGTATCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016662.4-757s21c1
Sequence:CCGGCCACATGTTGAAGAGACTAAACTCGAGTTTAGTCTCTTCAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016662
VALIDATED
MXD3 MISSION shRNA Lentiviral Transduction Particles
MAX dimerization protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016662.2-760s1c1
Sequence:CCGGCCACATGTTGAAGAGACTAAACTCGAGTTTAGTCTCTTCAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-556s1c1
Sequence:CCGGTCAGACTCAGACCAAGAGGATCTCGAGATCCTCTTGGTCTGAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-133s1c1
Sequence:CCGGAGAGAGGCAGAGCACGGTTATCTCGAGATAACCGTGCTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016662.2-334s1c1
Sequence:CCGGTGTACCCGATACACTACACTACTCGAGTAGTGTAGTGTATCGGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016662.2-335s1c1
Sequence:CCGGGTACCCGATACACTACACTAACTCGAGTTAGTGTAGTGTATCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-553s21c1
Sequence:CCGGTCAGACTCAGACCAAGAGGATCTCGAGATCCTCTTGGTCTGAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-130s21c1
Sequence:CCGGAGAGAGGCAGAGCACGGTTATCTCGAGATAACCGTGCTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016662.4-332s21c1
Sequence:CCGGGTACCCGATACACTACACTAACTCGAGTTAGTGTAGTGTATCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016662.4-757s21c1
Sequence:CCGGCCACATGTTGAAGAGACTAAACTCGAGTTTAGTCTCTTCAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks