EMAIL THIS PAGE TO A FRIEND

MXRA7

matrix-remodelling associated 7

Synonyms: PS1TP1 TMAP1
UniProtKB ID: P84157, Q0P5W3
Gene ID:
Mouse(67622) matrix-remodelling associated 7
Rat(690599) matrix-remodelling associated 7
Zebrafish(100034383) matrix-remodelling associated 7
chicken(769894) matrix-remodelling associated 7
cow(617087) matrix-remodelling associated 7
naked mole-rat(101716789) matrix-remodelling associated 7
domestic guinea pig(100728311) matrix-remodelling associated 7
sheep(101116331) matrix-remodelling associated 7
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198530 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008528 Rosetta Predictions human pricing
NM_001008529 Rosetta Predictions human pricing
NM_198530 Rosetta Predictions human pricing
XM_001074923 Rosetta Predictions rat pricing
NM_026280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305485 predicted 777
2 SASI_Hs01_00140080 predicted 2244
3 SASI_Hs01_00140082 predicted 1844
4 SASI_Hs01_00140084 predicted 1884
5 SASI_Hs01_00140085 predicted 1815
6 SASI_Hs01_00140086 predicted 1824
7 SASI_Hs02_00305486 predicted 1802
8 SASI_Hs02_00305487 predicted 1264
9 SASI_Hs02_00305488 predicted 2325
10 SASI_Hs02_00305489 predicted 2252
11 SASI_Hs01_00140077 predicted 2109
12 SASI_Hs01_00140078 predicted 1993
13 SASI_Hs01_00140079 predicted 2118
14 SASI_Hs01_00140081 predicted 1894
15 SASI_Hs01_00140083 predicted 2104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082204 predicted 725
2 SASI_Hs01_00082205 predicted 1022
3 SASI_Hs01_00082206 predicted 543
4 SASI_Hs02_00305490 predicted 82
5 SASI_Hs01_00082207 predicted 817
6 SASI_Hs01_00082208 predicted 726
7 SASI_Hs01_00082209 predicted 530
8 SASI_Hs01_00082210 predicted 580
9 SASI_Hs01_00082211 predicted 521
10 SASI_Hs01_00082212 predicted 581
11 SASI_Hs01_00082213 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223313 predicted 645
2 SASI_Hs01_00223314 predicted 950
3 SASI_Hs01_00223316 predicted 731
4 SASI_Hs01_00223317 predicted 635
5 SASI_Hs01_00223318 predicted 642
6 SASI_Hs01_00223319 predicted 764
7 SASI_Hs02_00372118 predicted 946
8 SASI_Hs01_00223320 predicted 661
9 SASI_Hs01_00223321 predicted 755
10 SASI_Hs01_00223322 predicted 940
11 SASI_Hs01_00223315 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347752 predicted 245
2 SASI_Rn02_00347753 predicted 251
3 SASI_Rn02_00347754 predicted 254
4 SASI_Rn02_00347755 predicted 276
5 SASI_Rn02_00347756 predicted 246
6 SASI_Rn02_00347757 predicted 284
7 SASI_Rn02_00347758 predicted 283
8 SASI_Rn02_00347759 predicted 273
9 SASI_Rn02_00347760 predicted 246
10 SASI_Rn02_00347761 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157677 predicted 702
2 SASI_Mm01_00157679 predicted 881
3 SASI_Mm01_00157680 predicted 960
4 SASI_Mm01_00157681 predicted 1014
5 SASI_Mm02_00329970 predicted 966
6 SASI_Mm01_00157682 predicted 940
7 SASI_Mm01_00157683 predicted 661
8 SASI_Mm01_00157684 predicted 701
9 SASI_Mm01_00157685 predicted 1043
10 SASI_Mm01_00157686 predicted 922
11 SASI_Mm01_00157678 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026280
MXRA7 MISSION shRNA Bacterial Glycerol Stock
matrix-remodelling associated 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026280.1-1416s1c1
Sequence:CCGGCCACATCTTGTTCTACTTCTTCTCGAGAAGAAGTAGAACAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-473s1c1
Sequence:CCGGGTTCAGAAAGAACAGCTGGCTCTCGAGAGCCAGCTGTTCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-317s1c1
Sequence:CCGGCAGGATGAAGACTCAGACAGTCTCGAGACTGTCTGAGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-511s1c1
Sequence:CCGGGAAGGACAACAAGGACACCTTCTCGAGAAGGTGTCCTTGTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-562s1c1
Sequence:CCGGGCAACTCCGACTCTATGACATCTCGAGATGTCATAGAGTCGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026280
MXRA7 MISSION shRNA shRNA Plasmid DNA
matrix-remodelling associated 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026280.1-1416s1c1
Sequence:CCGGCCACATCTTGTTCTACTTCTTCTCGAGAAGAAGTAGAACAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-473s1c1
Sequence:CCGGGTTCAGAAAGAACAGCTGGCTCTCGAGAGCCAGCTGTTCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-317s1c1
Sequence:CCGGCAGGATGAAGACTCAGACAGTCTCGAGACTGTCTGAGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-511s1c1
Sequence:CCGGGAAGGACAACAAGGACACCTTCTCGAGAAGGTGTCCTTGTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-562s1c1
Sequence:CCGGGCAACTCCGACTCTATGACATCTCGAGATGTCATAGAGTCGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026280
MXRA7 MISSION shRNA Lentiviral Transduction Particles
matrix-remodelling associated 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026280.1-1416s1c1
Sequence:CCGGCCACATCTTGTTCTACTTCTTCTCGAGAAGAAGTAGAACAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-473s1c1
Sequence:CCGGGTTCAGAAAGAACAGCTGGCTCTCGAGAGCCAGCTGTTCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-317s1c1
Sequence:CCGGCAGGATGAAGACTCAGACAGTCTCGAGACTGTCTGAGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-511s1c1
Sequence:CCGGGAAGGACAACAAGGACACCTTCTCGAGAAGGTGTCCTTGTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026280.1-562s1c1
Sequence:CCGGGCAACTCCGACTCTATGACATCTCGAGATGTCATAGAGTCGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198530
VALIDATED
MXRA7 MISSION shRNA Bacterial Glycerol Stock
matrix-remodelling associated 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-745s1c1
Sequence:CCGGGTAGAGATGTTCATGTCTGTTCTCGAGAACAGACATGAACATCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-484s1c1
Sequence:CCGGGTACAAGAAGATGATGACCAACTCGAGTTGGTCATCATCTTCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-477s1c1
Sequence:CCGGGAAACCAGTACAAGAAGATGACTCGAGTCATCTTCTTGTACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-960s1c1
Sequence:CCGGCTTTGAGGAATGAGAGACAAACTCGAGTTTGTCTCTCATTCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-1124s1c1
Sequence:CCGGCCAGGAATTTACTTGACCATTCTCGAGAATGGTCAAGTAAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-487s1c1
Sequence:CCGGCAAGAAGATGATGACCAAAGACTCGAGTCTTTGGTCATCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-1396s1c1
Sequence:CCGGCCAAACTCATTTGCAGTTCTTCTCGAGAAGAACTGCAAATGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-1333s1c1
Sequence:CCGGGATCATCAGATCAGTCTCAAACTCGAGTTTGAGACTGATCTGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-435s1c1
Sequence:CCGGGAGAAGGCTTCTCCTTCAAATCTCGAGATTTGAAGGAGAAGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-493s1c1
Sequence:CCGGGATGATGACCAAAGAGGAGCTCTCGAGAGCTCCTCTTTGGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-518s1c1
Sequence:CCGGGAGGAGCAGAGAACTGAAGAACTCGAGTTCTTCAGTTCTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-1664s1c1
Sequence:CCGGGCTGGGATCTAATTGACACAACTCGAGTTGTGTCAATTAGATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198530
VALIDATED
MXRA7 MISSION shRNA shRNA Plasmid DNA
matrix-remodelling associated 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-745s1c1
Sequence:CCGGGTAGAGATGTTCATGTCTGTTCTCGAGAACAGACATGAACATCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-484s1c1
Sequence:CCGGGTACAAGAAGATGATGACCAACTCGAGTTGGTCATCATCTTCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-477s1c1
Sequence:CCGGGAAACCAGTACAAGAAGATGACTCGAGTCATCTTCTTGTACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-960s1c1
Sequence:CCGGCTTTGAGGAATGAGAGACAAACTCGAGTTTGTCTCTCATTCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-1124s1c1
Sequence:CCGGCCAGGAATTTACTTGACCATTCTCGAGAATGGTCAAGTAAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-487s1c1
Sequence:CCGGCAAGAAGATGATGACCAAAGACTCGAGTCTTTGGTCATCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-1396s1c1
Sequence:CCGGCCAAACTCATTTGCAGTTCTTCTCGAGAAGAACTGCAAATGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-1333s1c1
Sequence:CCGGGATCATCAGATCAGTCTCAAACTCGAGTTTGAGACTGATCTGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-435s1c1
Sequence:CCGGGAGAAGGCTTCTCCTTCAAATCTCGAGATTTGAAGGAGAAGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-493s1c1
Sequence:CCGGGATGATGACCAAAGAGGAGCTCTCGAGAGCTCCTCTTTGGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-518s1c1
Sequence:CCGGGAGGAGCAGAGAACTGAAGAACTCGAGTTCTTCAGTTCTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-1664s1c1
Sequence:CCGGGCTGGGATCTAATTGACACAACTCGAGTTGTGTCAATTAGATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198530
VALIDATED
MXRA7 MISSION shRNA Lentiviral Transduction Particles
matrix-remodelling associated 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-745s1c1
Sequence:CCGGGTAGAGATGTTCATGTCTGTTCTCGAGAACAGACATGAACATCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-484s1c1
Sequence:CCGGGTACAAGAAGATGATGACCAACTCGAGTTGGTCATCATCTTCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-477s1c1
Sequence:CCGGGAAACCAGTACAAGAAGATGACTCGAGTCATCTTCTTGTACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-960s1c1
Sequence:CCGGCTTTGAGGAATGAGAGACAAACTCGAGTTTGTCTCTCATTCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-1124s1c1
Sequence:CCGGCCAGGAATTTACTTGACCATTCTCGAGAATGGTCAAGTAAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-487s1c1
Sequence:CCGGCAAGAAGATGATGACCAAAGACTCGAGTCTTTGGTCATCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-1396s1c1
Sequence:CCGGCCAAACTCATTTGCAGTTCTTCTCGAGAAGAACTGCAAATGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198530.2-1333s1c1
Sequence:CCGGGATCATCAGATCAGTCTCAAACTCGAGTTTGAGACTGATCTGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-435s1c1
Sequence:CCGGGAGAAGGCTTCTCCTTCAAATCTCGAGATTTGAAGGAGAAGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-493s1c1
Sequence:CCGGGATGATGACCAAAGAGGAGCTCTCGAGAGCTCCTCTTTGGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198530.2-518s1c1
Sequence:CCGGGAGGAGCAGAGAACTGAAGAACTCGAGTTCTTCAGTTCTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198530.2-1664s1c1
Sequence:CCGGGCTGGGATCTAATTGACACAACTCGAGTTGTGTCAATTAGATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks