EMAIL THIS PAGE TO A FRIEND

MYADM

myeloid-associated differentiation marker

Synonyms: SB135
Gene ID:
Mouse(50918) myeloid-associated differentiation marker
Rat(369016) myeloid-associated differentiation marker
sheep(101118632) myeloid-associated differentiation marker
naked mole-rat(101698725) myeloid-associated differentiation marker
Domestic Rabbit(100328773) myeloid-associated differentiation marker
domestic guinea pig(100734790) myeloid-associated differentiation marker
dog(611521) myeloid-associated differentiation marker
cow(506295) myeloid-associated differentiation marker
domestic cat(101082450) myeloid-associated differentiation marker
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016969 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016969 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016969 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001020818 Rosetta Predictions human pricing
NM_001020819 Rosetta Predictions human pricing
NM_001020820 Rosetta Predictions human pricing
NM_001020821 Rosetta Predictions human pricing
NM_138373 Rosetta Predictions human pricing
NM_183332 Rosetta Predictions rat pricing
NM_001093764 Rosetta Predictions mouse pricing
NM_001093765 Rosetta Predictions mouse pricing
NM_001093766 Rosetta Predictions mouse pricing
NM_016969 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001020818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216563 predicted 850
2 SASI_Hs01_00216564 predicted 996
3 SASI_Hs02_00307059 predicted 678
4 SASI_Hs01_00216565 predicted 1096
5 SASI_Hs01_00216566 predicted 536
6 SASI_Hs01_00216567 predicted 809
7 SASI_Hs01_00216568 predicted 545
8 SASI_Hs01_00216569 predicted 863
9 SASI_Hs01_00216570 predicted 1089
10 SASI_Hs02_00307060 predicted 850
11 SASI_Hs01_00216571 predicted 872
12 SASI_Hs01_00216572 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001020819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133174 predicted 744
2 SASI_Hs01_00133175 predicted 894
3 SASI_Hs02_00307061 predicted 576
4 SASI_Hs01_00133176 predicted 989
5 SASI_Hs01_00133177 predicted 431
6 SASI_Hs01_00133178 predicted 701
7 SASI_Hs01_00133179 predicted 442
8 SASI_Hs01_00133180 predicted 762
9 SASI_Hs01_00133181 predicted 988
10 SASI_Hs02_00307062 predicted 750
11 SASI_Hs01_00133182 predicted 763
12 SASI_Hs01_00133183 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001020820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199714 predicted 681
2 SASI_Hs01_00199715 predicted 822
3 SASI_Hs02_00307063 predicted 509
4 SASI_Hs01_00199716 predicted 922
5 SASI_Hs01_00199717 predicted 366
6 SASI_Hs01_00199718 predicted 641
7 SASI_Hs01_00199719 predicted 377
8 SASI_Hs01_00199720 predicted 693
9 SASI_Hs01_00199721 predicted 926
10 SASI_Hs02_00307064 predicted 687
11 SASI_Hs01_00199722 predicted 700
12 SASI_Hs01_00199723 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001020821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081629 predicted 815
2 SASI_Hs01_00081630 predicted 958
3 SASI_Hs02_00307065 predicted 640
4 SASI_Hs01_00081631 predicted 1062
5 SASI_Hs01_00081632 predicted 498
6 SASI_Hs01_00081633 predicted 778
7 SASI_Hs01_00081634 predicted 511
8 SASI_Hs01_00081635 predicted 823
9 SASI_Hs01_00081636 predicted 1053
10 SASI_Hs02_00307066 predicted 821
11 SASI_Hs01_00081637 predicted 837
12 SASI_Hs01_00081638 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048550 predicted 680
2 SASI_Hs01_00048551 predicted 827
3 SASI_Hs02_00363486 predicted 511
4 SASI_Hs01_00048552 predicted 921
5 SASI_Hs01_00048553 predicted 362
6 SASI_Hs01_00048554 predicted 638
7 SASI_Hs01_00048555 predicted 378
8 SASI_Hs01_00048556 predicted 696
9 SASI_Hs01_00048557 predicted 925
10 SASI_Hs02_00363487 predicted 684
11 SASI_Hs01_00048558 predicted 698
12 SASI_Hs01_00048559 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045760 predicted 394
2 SASI_Rn01_00045761 predicted 893
3 SASI_Rn01_00045762 predicted 205
4 SASI_Rn01_00045763 predicted 987
5 SASI_Rn01_00045765 predicted 473
6 SASI_Rn01_00045766 predicted 1010
7 SASI_Rn01_00045767 predicted 1168
8 SASI_Rn01_00045768 predicted 484
9 SASI_Rn01_00045769 predicted 786
10 SASI_Rn02_00269887 predicted 466
11 SASI_Rn01_00045764 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301109 predicted 585
2 SASI_Mm02_00301110 predicted 903
3 SASI_Mm02_00301111 predicted 1139
4 SASI_Mm02_00301112 predicted 558
5 SASI_Mm02_00301113 predicted 789
6 SASI_Mm02_00301114 predicted 595
7 SASI_Mm02_00301115 predicted 838
8 SASI_Mm02_00301116 predicted 1181
9 SASI_Mm02_00301117 predicted 735
10 SASI_Mm02_00301118 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301119 predicted 538
2 SASI_Mm02_00301120 predicted 852
3 SASI_Mm02_00301121 predicted 1083
4 SASI_Mm02_00301122 predicted 509
5 SASI_Mm02_00301123 predicted 739
6 SASI_Mm02_00301124 predicted 542
7 SASI_Mm02_00301125 predicted 792
8 SASI_Mm02_00301126 predicted 1133
9 SASI_Mm02_00301127 predicted 683
10 SASI_Mm02_00301128 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301129 predicted 475
2 SASI_Mm02_00301130 predicted 794
3 SASI_Mm02_00301131 predicted 1024
4 SASI_Mm02_00301132 predicted 448
5 SASI_Mm02_00301133 predicted 681
6 SASI_Mm02_00301134 predicted 489
7 SASI_Mm02_00301135 predicted 725
8 SASI_Mm02_00301136 predicted 1067
9 SASI_Mm02_00301137 predicted 617
10 SASI_Mm02_00301138 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074360 predicted 373
2 SASI_Mm01_00074361 predicted 698
3 SASI_Mm01_00074362 predicted 927
4 SASI_Mm02_00323819 predicted 350
5 SASI_Mm01_00074363 predicted 577
6 SASI_Mm01_00074364 predicted 384
7 SASI_Mm01_00074365 predicted 625
8 SASI_Mm01_00074366 predicted 972
9 SASI_Mm01_00074367 predicted 522
10 SASI_Mm01_00074368 predicted 924
11 SASI_Mm01_00074369 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138373
VALIDATED
MYADM MISSION shRNA Bacterial Glycerol Stock
myeloid-associated differentiation marker
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1050s21c1
Sequence:CCGGCCATCAACCTACTGGCGTATGCTCGAGCATACGCCAGTAGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-180s21c1
Sequence:CCGGCAACCACCACGACGTCATCTTCTCGAGAAGATGACGTCGTGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1259s21c1
Sequence:CCGGCCCAATTCCTTGCACTCTAACCTCGAGGTTAGAGTGCAAGGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138373.3-772s21c1
Sequence:CCGGGGTGTACGCCATCTGCTTCATCTCGAGATGAAGCAGATGGCGTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-379s21c1
Sequence:CCGGCGTGACCCTGATCATCCTCATCTCGAGATGAGGATGATCAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1111s21c1
Sequence:CCGGGGTCTAAGACTCTCCCAAGAGCTCGAGCTCTTGGGAGAGTCTTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1188s21c1
Sequence:CCGGTACTTCTTTCCTCCGCCTTTCCTCGAGGAAAGGCGGAGGAAAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-702s1c1
Sequence:CCGGGCATCATCTTCGCGTTCATCACTCGAGTGATGAACGCGAAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-925s1c1
Sequence:CCGGCCTCTACCAGTTCGATGAGAACTCGAGTTCTCATCGAACTGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138373.3-2133s1c1
Sequence:CCGGCCCAACTATTCTCTGTGGTATCTCGAGATACCACAGAGAATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-2121s1c1
Sequence:CCGGGATGCCTTTCATCCCAACTATCTCGAGATAGTTGGGATGAAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-2551s1c1
Sequence:CCGGCCTCTGTGTTAAGAATAACGTCTCGAGACGTTATTCTTAACACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138373
VALIDATED
MYADM MISSION shRNA shRNA Plasmid DNA
myeloid-associated differentiation marker
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1050s21c1
Sequence:CCGGCCATCAACCTACTGGCGTATGCTCGAGCATACGCCAGTAGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-180s21c1
Sequence:CCGGCAACCACCACGACGTCATCTTCTCGAGAAGATGACGTCGTGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1259s21c1
Sequence:CCGGCCCAATTCCTTGCACTCTAACCTCGAGGTTAGAGTGCAAGGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138373.3-772s21c1
Sequence:CCGGGGTGTACGCCATCTGCTTCATCTCGAGATGAAGCAGATGGCGTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-379s21c1
Sequence:CCGGCGTGACCCTGATCATCCTCATCTCGAGATGAGGATGATCAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1111s21c1
Sequence:CCGGGGTCTAAGACTCTCCCAAGAGCTCGAGCTCTTGGGAGAGTCTTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1188s21c1
Sequence:CCGGTACTTCTTTCCTCCGCCTTTCCTCGAGGAAAGGCGGAGGAAAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-702s1c1
Sequence:CCGGGCATCATCTTCGCGTTCATCACTCGAGTGATGAACGCGAAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-925s1c1
Sequence:CCGGCCTCTACCAGTTCGATGAGAACTCGAGTTCTCATCGAACTGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138373.3-2133s1c1
Sequence:CCGGCCCAACTATTCTCTGTGGTATCTCGAGATACCACAGAGAATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-2121s1c1
Sequence:CCGGGATGCCTTTCATCCCAACTATCTCGAGATAGTTGGGATGAAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-2551s1c1
Sequence:CCGGCCTCTGTGTTAAGAATAACGTCTCGAGACGTTATTCTTAACACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138373
VALIDATED
MYADM MISSION shRNA Lentiviral Transduction Particles
myeloid-associated differentiation marker
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1050s21c1
Sequence:CCGGCCATCAACCTACTGGCGTATGCTCGAGCATACGCCAGTAGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-180s21c1
Sequence:CCGGCAACCACCACGACGTCATCTTCTCGAGAAGATGACGTCGTGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1259s21c1
Sequence:CCGGCCCAATTCCTTGCACTCTAACCTCGAGGTTAGAGTGCAAGGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138373.3-772s21c1
Sequence:CCGGGGTGTACGCCATCTGCTTCATCTCGAGATGAAGCAGATGGCGTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-379s21c1
Sequence:CCGGCGTGACCCTGATCATCCTCATCTCGAGATGAGGATGATCAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1111s21c1
Sequence:CCGGGGTCTAAGACTCTCCCAAGAGCTCGAGCTCTTGGGAGAGTCTTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138373.3-1188s21c1
Sequence:CCGGTACTTCTTTCCTCCGCCTTTCCTCGAGGAAAGGCGGAGGAAAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-702s1c1
Sequence:CCGGGCATCATCTTCGCGTTCATCACTCGAGTGATGAACGCGAAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-925s1c1
Sequence:CCGGCCTCTACCAGTTCGATGAGAACTCGAGTTCTCATCGAACTGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138373.3-2133s1c1
Sequence:CCGGCCCAACTATTCTCTGTGGTATCTCGAGATACCACAGAGAATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-2121s1c1
Sequence:CCGGGATGCCTTTCATCCCAACTATCTCGAGATAGTTGGGATGAAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138373.3-2551s1c1
Sequence:CCGGCCTCTGTGTTAAGAATAACGTCTCGAGACGTTATTCTTAACACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016969
VALIDATED
MYADM MISSION shRNA Bacterial Glycerol Stock
myeloid-associated differentiation marker
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-1366s21c1
Sequence:CCGGTTTCTATCTCTATAGTCTTTCCTCGAGGAAAGACTATAGAGATAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-981s21c1
Sequence:CCGGGCTGCACTCGTAGTATTAGTTCTCGAGAACTAATACTACGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-727s21c1
Sequence:CCGGGCCGCTCCTGTATAATCAGAACTCGAGTTCTGATTATACAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016969.2-634s21c1
Sequence:CCGGCGGTGAGATCACTGGCTATATCTCGAGATATAGCCAGTGATCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016969.1-2247s1c1
Sequence:CCGGCGGCCTTAAAGGCATTAAGATCTCGAGATCTTAATGCCTTTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-1001s1c1
Sequence:CCGGGCTGCACTCGTAGTATTAGTTCTCGAGAACTAATACTACGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-748s1c1
Sequence:CCGGGCCGCTCCTGTATAATCAGAACTCGAGTTCTGATTATACAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-1004s1c1
Sequence:CCGGGCACTCGTAGTATTAGTTATACTCGAGTATAACTAATACTACGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-655s1c1
Sequence:CCGGCGGTGAGATCACTGGCTATATCTCGAGATATAGCCAGTGATCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016969
VALIDATED
MYADM MISSION shRNA shRNA Plasmid DNA
myeloid-associated differentiation marker
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-1366s21c1
Sequence:CCGGTTTCTATCTCTATAGTCTTTCCTCGAGGAAAGACTATAGAGATAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-981s21c1
Sequence:CCGGGCTGCACTCGTAGTATTAGTTCTCGAGAACTAATACTACGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-727s21c1
Sequence:CCGGGCCGCTCCTGTATAATCAGAACTCGAGTTCTGATTATACAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016969.2-634s21c1
Sequence:CCGGCGGTGAGATCACTGGCTATATCTCGAGATATAGCCAGTGATCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016969.1-2247s1c1
Sequence:CCGGCGGCCTTAAAGGCATTAAGATCTCGAGATCTTAATGCCTTTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-1001s1c1
Sequence:CCGGGCTGCACTCGTAGTATTAGTTCTCGAGAACTAATACTACGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-748s1c1
Sequence:CCGGGCCGCTCCTGTATAATCAGAACTCGAGTTCTGATTATACAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-1004s1c1
Sequence:CCGGGCACTCGTAGTATTAGTTATACTCGAGTATAACTAATACTACGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-655s1c1
Sequence:CCGGCGGTGAGATCACTGGCTATATCTCGAGATATAGCCAGTGATCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016969
VALIDATED
MYADM MISSION shRNA Lentiviral Transduction Particles
myeloid-associated differentiation marker
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-1366s21c1
Sequence:CCGGTTTCTATCTCTATAGTCTTTCCTCGAGGAAAGACTATAGAGATAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-981s21c1
Sequence:CCGGGCTGCACTCGTAGTATTAGTTCTCGAGAACTAATACTACGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016969.2-727s21c1
Sequence:CCGGGCCGCTCCTGTATAATCAGAACTCGAGTTCTGATTATACAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016969.2-634s21c1
Sequence:CCGGCGGTGAGATCACTGGCTATATCTCGAGATATAGCCAGTGATCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016969.1-2247s1c1
Sequence:CCGGCGGCCTTAAAGGCATTAAGATCTCGAGATCTTAATGCCTTTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-1001s1c1
Sequence:CCGGGCTGCACTCGTAGTATTAGTTCTCGAGAACTAATACTACGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-748s1c1
Sequence:CCGGGCCGCTCCTGTATAATCAGAACTCGAGTTCTGATTATACAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-1004s1c1
Sequence:CCGGGCACTCGTAGTATTAGTTATACTCGAGTATAACTAATACTACGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016969.1-655s1c1
Sequence:CCGGCGGTGAGATCACTGGCTATATCTCGAGATATAGCCAGTGATCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks