EMAIL THIS PAGE TO A FRIEND

MYH10

myosin, heavy chain 10, non-muscle

Synonyms: NMMHC-IIB NMMHCB
Gene ID:
Human(4628) Summary: This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(77579) myosin, heavy polypeptide 10, non-muscle
Rat(79433) myosin, heavy chain 10, non-muscle
Zebrafish(555454) myosin, heavy chain 10, non-muscle
cow(317655) myosin, heavy chain 10, non-muscle
Horse(100062708) myosin, heavy chain 10, non-muscle
domestic cat(101082861) myosin, heavy chain 10, non-muscle
dog(479497) myosin, heavy chain 10, non-muscle
chicken(396465) myosin, heavy chain 10, non-muscle
sheep(101108844) myosin, heavy chain 10, non-muscle
naked mole-rat(101719424) myosin, heavy chain 10, non-muscle
domestic guinea pig(100731176) myosin, heavy chain 10, non-muscle
Gene Class: Cytoskeleton
161 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005964 Rosetta Predictions human pricing
NM_031520 Rosetta Predictions rat pricing
NM_175260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072460 predicted 6040
2 SASI_Hs02_00340636 predicted 976
3 SASI_Hs01_00072461 predicted 360
4 SASI_Hs02_00340637 predicted 1291
5 SASI_Hs01_00072463 predicted 5218
6 SASI_Hs01_00072464 predicted 412
7 SASI_Hs02_00340638 predicted 963
8 SASI_Hs01_00072467 predicted 2180
9 SASI_Hs02_00340639 predicted 4986
10 SASI_Hs01_00072468 predicted 555
11 SASI_Hs01_00072462 predicted 2039
12 SASI_Hs01_00072465 predicted 5618
13 SASI_Hs01_00072466 predicted 1642
14 SASI_Hs01_00072469 predicted 3191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043197 predicted 4334
2 SASI_Rn01_00043198 predicted 1007
3 SASI_Rn01_00043199 predicted 562
4 SASI_Rn02_00264648 predicted 575
5 SASI_Rn01_00043200 predicted 2209
6 SASI_Rn01_00043201 predicted 3032
7 SASI_Rn01_00043202 predicted 700
8 SASI_Rn01_00043205 predicted 3200
9 SASI_Rn02_00264649 predicted 5091
10 SASI_Rn02_00264650 predicted 2220
11 SASI_Rn01_00043203 predicted 915
12 SASI_Rn01_00043204 predicted 5079
13 SASI_Rn01_00043206 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163445 predicted 757
2 SASI_Mm01_00163446 predicted 1495
3 SASI_Mm01_00163447 predicted 620
4 SASI_Mm01_00163448 predicted 3394
5 SASI_Mm01_00163449 predicted 5220
6 SASI_Mm01_00163450 predicted 5181
7 SASI_Mm02_00345966 predicted 1528
8 SASI_Mm01_00163451 predicted 585
9 SASI_Mm01_00163452 predicted 3158
10 SASI_Mm01_00163453 predicted 5812
11 SASI_Mm01_00163454 predicted 5929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005964
VALIDATED
MYH10 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 10, non-muscle
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005964.1-6115s1c1
Sequence:CCGGCGGGATTCCTTCCTGAAAGATCTCGAGATCTTTCAGGAAGGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-871s1c1
Sequence:CCGGGCCAACATTGAAACATACCTTCTCGAGAAGGTATGTTTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-2944s1c1
Sequence:CCGGGCACATATTCAGGACCTGGAACTCGAGTTCCAGGTCCTGAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-5725s1c1
Sequence:CCGGGCTCGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-4024s1c1
Sequence:CCGGGCAGCTAGTCTTGAGTCTCAACTCGAGTTGAGACTCAAGACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-871s21c1
Sequence:CCGGGCCAACATTGAAACATACCTTCTCGAGAAGGTATGTTTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-4024s21c1
Sequence:CCGGGCAGCTAGTCTTGAGTCTCAACTCGAGTTGAGACTCAAGACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-5725s21c1
Sequence:CCGGGCTCGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-2944s21c1
Sequence:CCGGGCACATATTCAGGACCTGGAACTCGAGTTCCAGGTCCTGAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-6115s21c1
Sequence:CCGGCGGGATTCCTTCCTGAAAGATCTCGAGATCTTTCAGGAAGGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005964
VALIDATED
MYH10 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 10, non-muscle
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005964.1-6115s1c1
Sequence:CCGGCGGGATTCCTTCCTGAAAGATCTCGAGATCTTTCAGGAAGGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-871s1c1
Sequence:CCGGGCCAACATTGAAACATACCTTCTCGAGAAGGTATGTTTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-2944s1c1
Sequence:CCGGGCACATATTCAGGACCTGGAACTCGAGTTCCAGGTCCTGAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-5725s1c1
Sequence:CCGGGCTCGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-4024s1c1
Sequence:CCGGGCAGCTAGTCTTGAGTCTCAACTCGAGTTGAGACTCAAGACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-871s21c1
Sequence:CCGGGCCAACATTGAAACATACCTTCTCGAGAAGGTATGTTTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-4024s21c1
Sequence:CCGGGCAGCTAGTCTTGAGTCTCAACTCGAGTTGAGACTCAAGACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-5725s21c1
Sequence:CCGGGCTCGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-2944s21c1
Sequence:CCGGGCACATATTCAGGACCTGGAACTCGAGTTCCAGGTCCTGAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-6115s21c1
Sequence:CCGGCGGGATTCCTTCCTGAAAGATCTCGAGATCTTTCAGGAAGGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005964
VALIDATED
MYH10 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 10, non-muscle
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005964.1-6115s1c1
Sequence:CCGGCGGGATTCCTTCCTGAAAGATCTCGAGATCTTTCAGGAAGGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-871s1c1
Sequence:CCGGGCCAACATTGAAACATACCTTCTCGAGAAGGTATGTTTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-2944s1c1
Sequence:CCGGGCACATATTCAGGACCTGGAACTCGAGTTCCAGGTCCTGAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-5725s1c1
Sequence:CCGGGCTCGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005964.1-4024s1c1
Sequence:CCGGGCAGCTAGTCTTGAGTCTCAACTCGAGTTGAGACTCAAGACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-871s21c1
Sequence:CCGGGCCAACATTGAAACATACCTTCTCGAGAAGGTATGTTTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-4024s21c1
Sequence:CCGGGCAGCTAGTCTTGAGTCTCAACTCGAGTTGAGACTCAAGACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-5725s21c1
Sequence:CCGGGCTCGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-2944s21c1
Sequence:CCGGGCACATATTCAGGACCTGGAACTCGAGTTCCAGGTCCTGAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005964.1-6115s21c1
Sequence:CCGGCGGGATTCCTTCCTGAAAGATCTCGAGATCTTTCAGGAAGGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175260
VALIDATED
MYH10 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 10, non-muscle
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-637s1c1
Sequence:CCGGCCTTCCAATTTACTCTGAGAACTCGAGTTCTCAGAGTAAATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175260.1-5876s1c1
Sequence:CCGGGCCAGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-2677s1c1
Sequence:CCGGGCAACAACTAAGTGCCTTAAACTCGAGTTTAAGGCACTTAGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-568s1c1
Sequence:CCGGCCGCTACTATTCAGGACTTATCTCGAGATAAGTCCTGAATAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-6379s1c1
Sequence:CCGGCCTCCACAAGACATGCGTATTCTCGAGAATACGCATGTCTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175260
VALIDATED
MYH10 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 10, non-muscle
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-637s1c1
Sequence:CCGGCCTTCCAATTTACTCTGAGAACTCGAGTTCTCAGAGTAAATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175260.1-5876s1c1
Sequence:CCGGGCCAGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-2677s1c1
Sequence:CCGGGCAACAACTAAGTGCCTTAAACTCGAGTTTAAGGCACTTAGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-568s1c1
Sequence:CCGGCCGCTACTATTCAGGACTTATCTCGAGATAAGTCCTGAATAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-6379s1c1
Sequence:CCGGCCTCCACAAGACATGCGTATTCTCGAGAATACGCATGTCTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175260
VALIDATED
MYH10 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 10, non-muscle
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-637s1c1
Sequence:CCGGCCTTCCAATTTACTCTGAGAACTCGAGTTCTCAGAGTAAATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175260.1-5876s1c1
Sequence:CCGGGCCAGGATGAAGCAGCTTAAACTCGAGTTTAAGCTGCTTCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-2677s1c1
Sequence:CCGGGCAACAACTAAGTGCCTTAAACTCGAGTTTAAGGCACTTAGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-568s1c1
Sequence:CCGGCCGCTACTATTCAGGACTTATCTCGAGATAAGTCCTGAATAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175260.1-6379s1c1
Sequence:CCGGCCTCCACAAGACATGCGTATTCTCGAGAATACGCATGTCTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks