EMAIL THIS PAGE TO A FRIEND

MYH4

myosin, heavy chain 4, skeletal muscle

Synonyms: MYH2B MyHC-2B MyHC-IIb
UniProtKB ID: Q9Y623
Gene ID:
Mouse(17884) myosin, heavy polypeptide 4, skeletal muscle
Rat(360543) myosin, heavy chain 4, skeletal muscle
dog(479502) myosin, heavy chain 4, skeletal muscle
Horse(100062919) myosin, heavy chain 4, skeletal muscle pseudogene
cow(408020) myosin, heavy chain 4, skeletal muscle
domestic cat(101085080) myosin, heavy chain 4, skeletal muscle
domestic guinea pig(100726456) myosin, heavy chain 4, skeletal muscle
naked mole-rat(101698292) myosin, heavy chain 4, skeletal muscle
sheep(101111980) myosin, heavy chain 4, skeletal muscle
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301129 Anti-MYH4 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017533 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017533 Rosetta Predictions human pricing
NM_019325 Rosetta Predictions rat pricing
NM_010855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244834 predicted 1028
2 SASI_Hs01_00244836 predicted 4793
3 SASI_Hs02_00350155 predicted 5123
4 SASI_Hs02_00350156 predicted 2272
5 SASI_Hs01_00244838 predicted 2379
6 SASI_Hs01_00244840 predicted 1258
7 SASI_Hs01_00244841 predicted 2775
8 SASI_Hs02_00350157 predicted 5788
9 SASI_Hs01_00244842 predicted 5032
10 SASI_Hs02_00350158 predicted 4081
11 SASI_Hs01_00244835 predicted 5627
12 SASI_Hs01_00244837 predicted 2121
13 SASI_Hs01_00244839 predicted 4036
14 SASI_Hs01_00244843 predicted 3819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037206 predicted 4325
2 SASI_Rn01_00037207 predicted 870
3 SASI_Rn02_00262297 predicted 1937
4 SASI_Rn01_00037208 predicted 829
5 SASI_Rn01_00037209 predicted 5612
6 SASI_Rn01_00037210 predicted 4922
7 SASI_Rn01_00037211 predicted 2259
8 SASI_Rn01_00037212 predicted 4599
9 SASI_Rn01_00037213 predicted 289
10 SASI_Rn01_00037214 predicted 2334
11 SASI_Rn01_00037215 predicted 3983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184139 predicted 1936
2 SASI_Mm01_00184140 predicted 1607
3 SASI_Mm01_00184141 predicted 4011
4 SASI_Mm01_00184142 predicted 5592
5 SASI_Mm01_00184143 predicted 927
6 SASI_Mm01_00184144 predicted 2329
7 SASI_Mm01_00184145 predicted 3903
8 SASI_Mm01_00184146 predicted 5700
9 SASI_Mm01_00184147 predicted 970
10 SASI_Mm01_00184148 predicted 2253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017533
MYH4 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 4, skeletal muscle
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4434s21c1
Sequence:CCGGTGCCTGCATAGCTCTCGATAACTCGAGTTATCGAGAGCTATGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4411s21c1
Sequence:CCGGATTGATGTGGAACGATCTAATCTCGAGATTAGATCGTTCCACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-3912s21c1
Sequence:CCGGAGAAGAGCAACAACGCTTAATCTCGAGATTAAGCGTTGTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017533.1-1338s1c1
Sequence:CCGGCGGCAATGAGTTCGTAACCAACTCGAGTTGGTTACGAACTCATTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-2385s21c1
Sequence:CCGGCCAGTACAAATTCGGTCATACCTCGAGGTATGACCGAATTTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4801s21c1
Sequence:CCGGCGCATTCAACTTGAGCTAAATCTCGAGATTTAGCTCAAGTTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017533.1-2755s1c1
Sequence:CCGGGTGACGCTAATGCAAGAGAAACTCGAGTTTCTCTTGCATTAGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017533
MYH4 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 4, skeletal muscle
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4434s21c1
Sequence:CCGGTGCCTGCATAGCTCTCGATAACTCGAGTTATCGAGAGCTATGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4411s21c1
Sequence:CCGGATTGATGTGGAACGATCTAATCTCGAGATTAGATCGTTCCACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-3912s21c1
Sequence:CCGGAGAAGAGCAACAACGCTTAATCTCGAGATTAAGCGTTGTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017533.1-1338s1c1
Sequence:CCGGCGGCAATGAGTTCGTAACCAACTCGAGTTGGTTACGAACTCATTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-2385s21c1
Sequence:CCGGCCAGTACAAATTCGGTCATACCTCGAGGTATGACCGAATTTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4801s21c1
Sequence:CCGGCGCATTCAACTTGAGCTAAATCTCGAGATTTAGCTCAAGTTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017533.1-2755s1c1
Sequence:CCGGGTGACGCTAATGCAAGAGAAACTCGAGTTTCTCTTGCATTAGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017533
MYH4 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 4, skeletal muscle
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4434s21c1
Sequence:CCGGTGCCTGCATAGCTCTCGATAACTCGAGTTATCGAGAGCTATGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4411s21c1
Sequence:CCGGATTGATGTGGAACGATCTAATCTCGAGATTAGATCGTTCCACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-3912s21c1
Sequence:CCGGAGAAGAGCAACAACGCTTAATCTCGAGATTAAGCGTTGTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017533.1-1338s1c1
Sequence:CCGGCGGCAATGAGTTCGTAACCAACTCGAGTTGGTTACGAACTCATTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-2385s21c1
Sequence:CCGGCCAGTACAAATTCGGTCATACCTCGAGGTATGACCGAATTTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017533.2-4801s21c1
Sequence:CCGGCGCATTCAACTTGAGCTAAATCTCGAGATTTAGCTCAAGTTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017533.1-2755s1c1
Sequence:CCGGGTGACGCTAATGCAAGAGAAACTCGAGTTTCTCTTGCATTAGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010855
MYH4 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 4, skeletal muscle
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-2688s1c1
Sequence:CCGGTCTGGCTAAGTCAGAGGCAAACTCGAGTTTGCCTCTGACTTAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-3905s1c1
Sequence:CCGGGCCTGATCAATGAACTGTCAACTCGAGTTGACAGTTCATTGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-5704s1c1
Sequence:CCGGGTGGACAAACTACAGACTAAACTCGAGTTTAGTCTGTAGTTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-334s1c1
Sequence:CCGGCCTCCCAAGTACGACAAGATTCTCGAGAATCTTGTCGTACTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-4752s1c1
Sequence:CCGGCCTTGAACATGAAGAAGGTAACTCGAGTTACCTTCTTCATGTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010855
MYH4 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 4, skeletal muscle
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-2688s1c1
Sequence:CCGGTCTGGCTAAGTCAGAGGCAAACTCGAGTTTGCCTCTGACTTAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-3905s1c1
Sequence:CCGGGCCTGATCAATGAACTGTCAACTCGAGTTGACAGTTCATTGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-5704s1c1
Sequence:CCGGGTGGACAAACTACAGACTAAACTCGAGTTTAGTCTGTAGTTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-334s1c1
Sequence:CCGGCCTCCCAAGTACGACAAGATTCTCGAGAATCTTGTCGTACTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-4752s1c1
Sequence:CCGGCCTTGAACATGAAGAAGGTAACTCGAGTTACCTTCTTCATGTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010855
MYH4 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 4, skeletal muscle
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-2688s1c1
Sequence:CCGGTCTGGCTAAGTCAGAGGCAAACTCGAGTTTGCCTCTGACTTAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-3905s1c1
Sequence:CCGGGCCTGATCAATGAACTGTCAACTCGAGTTGACAGTTCATTGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-5704s1c1
Sequence:CCGGGTGGACAAACTACAGACTAAACTCGAGTTTAGTCTGTAGTTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-334s1c1
Sequence:CCGGCCTCCCAAGTACGACAAGATTCTCGAGAATCTTGTCGTACTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010855.2-4752s1c1
Sequence:CCGGCCTTGAACATGAAGAAGGTAACTCGAGTTACCTTCTTCATGTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks