EMAIL THIS PAGE TO A FRIEND

MYH9

myosin, heavy chain 9, non-muscle

Synonyms: BDPLT6 DFNA17 EPSTS FTNS MHA NMHC-II-A NMMHC-IIA NMMHCA
UniProtKB ID: P35579, O60805, Q86T83
Gene ID:
Human(4627) Summary: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]
Mouse(17886) myosin, heavy polypeptide 9, non-muscle
Rat(25745) myosin, heavy chain 9, non-muscle
sheep(101106321) myosin, heavy chain 9, non-muscle
naked mole-rat(101702863) myosin, heavy chain 9, non-muscle
domestic guinea pig(100718592) myosin, heavy chain 9, non-muscle
chicken(396469) myosin, heavy chain 9, non-muscle
cow(404108) myosin, heavy chain 9, non-muscle
Horse(100054482) myosin, heavy chain 9, non-muscle
domestic cat(101093785) myosin, heavy chain 9, non-muscle
dog(481280) myosin, heavy chain 9, non-muscle
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108692 Anti-MYH9 affinity isolated antibody mouse, rat, pig, mouse, human, guinea pig, rabbit
western blot pricing
HPA001644 Anti-MYH9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2101542 Anti-MYH9 antibody produced in rabbit affinity isolated antibody mouse, canine, guinea pig, rat, human, rabbit
western blot pricing
M7648 Anti-Myosin (Skeletal and Smooth) antibody produced in rabbit whole antiserum animal, human
immunofluorescence pricing
M8064 Anti-Myosin IIA, non muscle antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, canine
immunofluorescence, microarray, western blot pricing
WH0004627M3 Monoclonal Anti-MYH9 antibody produced in mouse clone 2B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404102 Monoclonal Anti-MYH9 antibody produced in mouse clone 3C7, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1409335 Monoclonal Anti-MYH9 antibody produced in mouse clone 4D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409336 Monoclonal Anti-MYH9 antibody produced in mouse clone 1H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409337 Monoclonal Anti-MYH9 antibody produced in mouse clone 4H3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002473 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002473 Rosetta Predictions human pricing
NM_013194 Rosetta Predictions rat pricing
NM_022410 Rosetta Predictions mouse pricing
NM_181327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197338 predicted 3170
2 SASI_Hs01_00197339 predicted 579
3 SASI_Hs01_00197340 predicted 1331
4 SASI_Hs01_00197341 predicted 5911
5 SASI_Hs01_00197342 predicted 5082
6 SASI_Hs01_00197343 predicted 896
7 SASI_Hs01_00197344 predicted 6059
8 SASI_Hs01_00197345 predicted 1562
9 SASI_Hs01_00197346 predicted 1317
10 SASI_Hs01_00197347 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089943 predicted 5279
2 SASI_Rn01_00089944 predicted 974
3 SASI_Rn01_00089945 predicted 373
4 SASI_Rn01_00089946 predicted 1626
5 SASI_Rn01_00089948 predicted 720
6 SASI_Rn01_00089950 predicted 2188
7 SASI_Rn01_00089951 predicted 2027
8 SASI_Rn01_00089952 predicted 2525
9 SASI_Rn02_00261063 predicted 4393
10 SASI_Rn02_00261064 predicted 1586
11 SASI_Rn01_00089947 predicted 3306
12 SASI_Rn01_00089949 predicted 1542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041532 predicted 909
2 SASI_Mm01_00041533 predicted 528
3 SASI_Mm02_00326583 predicted 5077
4 SASI_Mm02_00326584 predicted 5049
5 SASI_Mm02_00326585 predicted 1120
6 SASI_Mm02_00326586 predicted 1786
7 SASI_Mm02_00326587 predicted 2499
8 SASI_Mm01_00041526 predicted 324
9 SASI_Mm02_00326588 predicted 1137
10 SASI_Mm02_00326589 predicted 883
11 SASI_Mm01_00041524 predicted 237
12 SASI_Mm01_00041525 predicted 284
13 SASI_Mm01_00041527 predicted 308
14 SASI_Mm01_00041528 predicted 233
15 SASI_Mm01_00041529 predicted 246
16 SASI_Mm01_00041530 predicted 269
17 SASI_Mm01_00041531 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044369 predicted 241
2 SASI_Mm01_00044370 predicted 290
3 SASI_Mm01_00044371 predicted 324
4 SASI_Mm01_00044372 predicted 323
5 SASI_Mm01_00044373 predicted 235
6 SASI_Mm01_00044374 predicted 257
7 SASI_Mm01_00044375 predicted 278
8 SASI_Mm01_00044376 predicted 437
9 SASI_Mm01_00044377 predicted 522
10 SASI_Mm01_00044378 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002473
VALIDATED
MYH9 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 9, non-muscle
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002473.2-885s1c1
Sequence:CCGGGCCGTACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-2248s1c1
Sequence:CCGGGACAGCAATCTGTACCGCATTCTCGAGAATGCGGTACAGATTGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-5733s1c1
Sequence:CCGGCCGCGAAGTCAGCTCCCTAAACTCGAGTTTAGGGAGCTGACTTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-718s1c1
Sequence:CCGGCGCATCAACTTTGATGTCAATCTCGAGATTGACATCAAAGTTGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-3055s1c1
Sequence:CCGGGCCAAGCTCAAGAACAAGCATCTCGAGATGCTTGTTCTTGAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-6220s21c1
Sequence:CCGGCAGGTGTTGTTGAGGGCATTTCTCGAGAAATGCCCTCAACAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-2432s21c1
Sequence:CCGGGACAGCAATCTGTACCGCATTCTCGAGAATGCGGTACAGATTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-4694s21c1
Sequence:CCGGACGGAGATGGAGGACCTTATGCTCGAGCATAAGGTCCTCCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-5917s21c1
Sequence:CCGGCCGCGAAGTCAGCTCCCTAAACTCGAGTTTAGGGAGCTGACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-3239s21c1
Sequence:CCGGGCCAAGCTCAAGAACAAGCATCTCGAGATGCTTGTTCTTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002473
VALIDATED
MYH9 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 9, non-muscle
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002473.2-885s1c1
Sequence:CCGGGCCGTACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-2248s1c1
Sequence:CCGGGACAGCAATCTGTACCGCATTCTCGAGAATGCGGTACAGATTGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-5733s1c1
Sequence:CCGGCCGCGAAGTCAGCTCCCTAAACTCGAGTTTAGGGAGCTGACTTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-718s1c1
Sequence:CCGGCGCATCAACTTTGATGTCAATCTCGAGATTGACATCAAAGTTGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-3055s1c1
Sequence:CCGGGCCAAGCTCAAGAACAAGCATCTCGAGATGCTTGTTCTTGAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-6220s21c1
Sequence:CCGGCAGGTGTTGTTGAGGGCATTTCTCGAGAAATGCCCTCAACAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-2432s21c1
Sequence:CCGGGACAGCAATCTGTACCGCATTCTCGAGAATGCGGTACAGATTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-4694s21c1
Sequence:CCGGACGGAGATGGAGGACCTTATGCTCGAGCATAAGGTCCTCCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-5917s21c1
Sequence:CCGGCCGCGAAGTCAGCTCCCTAAACTCGAGTTTAGGGAGCTGACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-3239s21c1
Sequence:CCGGGCCAAGCTCAAGAACAAGCATCTCGAGATGCTTGTTCTTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002473
VALIDATED
MYH9 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 9, non-muscle
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002473.2-885s1c1
Sequence:CCGGGCCGTACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-2248s1c1
Sequence:CCGGGACAGCAATCTGTACCGCATTCTCGAGAATGCGGTACAGATTGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-5733s1c1
Sequence:CCGGCCGCGAAGTCAGCTCCCTAAACTCGAGTTTAGGGAGCTGACTTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-718s1c1
Sequence:CCGGCGCATCAACTTTGATGTCAATCTCGAGATTGACATCAAAGTTGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002473.2-3055s1c1
Sequence:CCGGGCCAAGCTCAAGAACAAGCATCTCGAGATGCTTGTTCTTGAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-6220s21c1
Sequence:CCGGCAGGTGTTGTTGAGGGCATTTCTCGAGAAATGCCCTCAACAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-2432s21c1
Sequence:CCGGGACAGCAATCTGTACCGCATTCTCGAGAATGCGGTACAGATTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-4694s21c1
Sequence:CCGGACGGAGATGGAGGACCTTATGCTCGAGCATAAGGTCCTCCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-5917s21c1
Sequence:CCGGCCGCGAAGTCAGCTCCCTAAACTCGAGTTTAGGGAGCTGACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002473.3-3239s21c1
Sequence:CCGGGCCAAGCTCAAGAACAAGCATCTCGAGATGCTTGTTCTTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022410
VALIDATED
MYH9 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 9, non-muscle
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022410.1-6980s1c1
Sequence:CCGGGCCCTGGAACTGTGTTTAGAACTCGAGTTCTAAACACAGTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022410.1-867s1c1
Sequence:CCGGCGGTAAATTCATTCGTATCAACTCGAGTTGATACGAATGAATTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022410.1-5032s1c1
Sequence:CCGGGCACACATTGACACAGCCAATCTCGAGATTGGCTGTGTCAATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022410.1-1047s1c1
Sequence:CCGGGCCATACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022410.1-471s1c1
Sequence:CCGGGCGATACTACTCAGGGCTTATCTCGAGATAAGCCCTGAGTAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-487s21c1
Sequence:CCGGGCGATACTACTCAGGGCTTATCTCGAGATAAGCCCTGAGTAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-1063s21c1
Sequence:CCGGGCCATACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-883s21c1
Sequence:CCGGCGGTAAATTCATTCGTATCAACTCGAGTTGATACGAATGAATTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022410.2-6220s21c1
Sequence:CCGGTACCCTTTGAGAATCTGATACCTCGAGGTATCAGATTCTCAAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-1896s21c1
Sequence:CCGGATGCCGGCAAGGTGGACTATACTCGAGTATAGTCCACCTTGCCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022410
VALIDATED
MYH9 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 9, non-muscle
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022410.1-6980s1c1
Sequence:CCGGGCCCTGGAACTGTGTTTAGAACTCGAGTTCTAAACACAGTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022410.1-867s1c1
Sequence:CCGGCGGTAAATTCATTCGTATCAACTCGAGTTGATACGAATGAATTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022410.1-5032s1c1
Sequence:CCGGGCACACATTGACACAGCCAATCTCGAGATTGGCTGTGTCAATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022410.1-1047s1c1
Sequence:CCGGGCCATACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022410.1-471s1c1
Sequence:CCGGGCGATACTACTCAGGGCTTATCTCGAGATAAGCCCTGAGTAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-487s21c1
Sequence:CCGGGCGATACTACTCAGGGCTTATCTCGAGATAAGCCCTGAGTAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-1063s21c1
Sequence:CCGGGCCATACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-883s21c1
Sequence:CCGGCGGTAAATTCATTCGTATCAACTCGAGTTGATACGAATGAATTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022410.2-6220s21c1
Sequence:CCGGTACCCTTTGAGAATCTGATACCTCGAGGTATCAGATTCTCAAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-1896s21c1
Sequence:CCGGATGCCGGCAAGGTGGACTATACTCGAGTATAGTCCACCTTGCCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022410
VALIDATED
MYH9 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 9, non-muscle
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022410.1-6980s1c1
Sequence:CCGGGCCCTGGAACTGTGTTTAGAACTCGAGTTCTAAACACAGTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022410.1-867s1c1
Sequence:CCGGCGGTAAATTCATTCGTATCAACTCGAGTTGATACGAATGAATTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022410.1-5032s1c1
Sequence:CCGGGCACACATTGACACAGCCAATCTCGAGATTGGCTGTGTCAATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022410.1-1047s1c1
Sequence:CCGGGCCATACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022410.1-471s1c1
Sequence:CCGGGCGATACTACTCAGGGCTTATCTCGAGATAAGCCCTGAGTAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-487s21c1
Sequence:CCGGGCGATACTACTCAGGGCTTATCTCGAGATAAGCCCTGAGTAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-1063s21c1
Sequence:CCGGGCCATACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-883s21c1
Sequence:CCGGCGGTAAATTCATTCGTATCAACTCGAGTTGATACGAATGAATTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022410.2-6220s21c1
Sequence:CCGGTACCCTTTGAGAATCTGATACCTCGAGGTATCAGATTCTCAAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022410.2-1896s21c1
Sequence:CCGGATGCCGGCAAGGTGGACTATACTCGAGTATAGTCCACCTTGCCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks