EMAIL THIS PAGE TO A FRIEND

MYL4

myosin, light chain 4, alkali; atrial, embryonic

Synonyms: ALC1 AMLC GT1
UniProtKB ID: P12829, D3DXJ7, P11783
Gene ID:
Human(4635) Summary: Myosin is a hexameric ATPase cellular motor protein. It is composed of two myosin heavy chains, two nonphosphorylatable myosin alkali light chains, and two phosphorylatable myosin regulatory light chains. This gene encodes a myosin alkali light chain that is found in embryonic muscle and adult atria. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17896) myosin, light polypeptide 4
Rat(688228) myosin, light chain 4
sheep(101121691) myosin, light chain 4, alkali; atrial, embryonic
naked mole-rat(101716492) myosin, light chain 4, alkali; atrial, embryonic
domestic guinea pig(100713818) myosin, light chain 4, alkali; atrial, embryonic
chicken(396472) myosin, light chain 4, alkali; atrial, embryonic
domestic cat(100316866) myosin, light chain 4, alkali; atrial, embryonic
cow(504201) myosin, light chain 4, alkali; atrial, embryonic
dog(480490) myosin, light chain 4, alkali; atrial, embryonic
Gene Class: Calcium_Binding
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002841 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002841 Rosetta Predictions human pricing
NM_002476 Rosetta Predictions human pricing
NM_001109495 Rosetta Predictions rat pricing
NM_010858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041588 predicted 673
2 SASI_Hs01_00041589 predicted 427
3 SASI_Hs01_00041591 predicted 448
4 SASI_Hs01_00041592 predicted 643
5 SASI_Hs01_00041594 predicted 461
6 SASI_Hs01_00041595 predicted 675
7 SASI_Hs01_00041596 predicted 484
8 SASI_Hs02_00304225 predicted 422
9 SASI_Hs02_00304226 predicted 495
10 SASI_Hs01_00041590 predicted 540
11 SASI_Hs01_00041587 predicted 434
12 SASI_Hs01_00041593 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121297 predicted 624
2 SASI_Hs01_00121298 predicted 375
3 SASI_Hs01_00121300 predicted 387
4 SASI_Hs01_00121301 predicted 592
5 SASI_Hs01_00121303 predicted 416
6 SASI_Hs01_00121304 predicted 617
7 SASI_Hs01_00121305 predicted 434
8 SASI_Hs02_00333903 predicted 371
9 SASI_Hs02_00333904 predicted 448
10 SASI_Hs01_00121299 predicted 492
11 SASI_Hs01_00121296 predicted 382
12 SASI_Hs01_00121302 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248959 predicted 473
2 SASI_Rn02_00248960 predicted 247
3 SASI_Rn02_00248961 predicted 204
4 SASI_Rn02_00248962 predicted 200
5 SASI_Rn02_00248963 predicted 504
6 SASI_Rn02_00248964 predicted 418
7 SASI_Rn02_00248965 predicted 362
8 SASI_Rn02_00248966 predicted 573
9 SASI_Rn02_00248967 predicted 377
10 SASI_Rn02_00248968 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174558 predicted 281
2 SASI_Mm01_00174559 predicted 438
3 SASI_Mm01_00174560 predicted 247
4 SASI_Mm01_00174561 predicted 273
5 SASI_Mm01_00174562 predicted 342
6 SASI_Mm01_00174563 predicted 252
7 SASI_Mm01_00174564 predicted 252
8 SASI_Mm01_00174565 predicted 243
9 SASI_Mm01_00174566 predicted 279
10 SASI_Mm01_00174567 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002841
MYL4 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 4, alkali; atrial, embryonic
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002841.1-480s21c1
Sequence:CCGGCCCATCCTGCAGCACATTTCCCTCGAGGGAAATGTGCTGCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002841.1-539s21c1
Sequence:CCGGGGGCCTGCGTGTCTTTGACAACTCGAGTTGTCAAAGACACGCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002841.1-758s1c1
Sequence:CCGGGCCATACCAGGGTGAGTTAAACTCGAGTTTAACTCACCCTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-458s1c1
Sequence:CCGGGCTGGACTTTGAGACGTTCTTCTCGAGAAGAACGTCTCAAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-434s1c1
Sequence:CCGGGCCTGAAGAGATGAATGTCAACTCGAGTTGACATTCATCTCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-666s1c1
Sequence:CCGGGATGCCAATGGCTGCATCAATCTCGAGATTGATGCAGCCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002841
MYL4 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 4, alkali; atrial, embryonic
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002841.1-480s21c1
Sequence:CCGGCCCATCCTGCAGCACATTTCCCTCGAGGGAAATGTGCTGCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002841.1-539s21c1
Sequence:CCGGGGGCCTGCGTGTCTTTGACAACTCGAGTTGTCAAAGACACGCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002841.1-758s1c1
Sequence:CCGGGCCATACCAGGGTGAGTTAAACTCGAGTTTAACTCACCCTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-458s1c1
Sequence:CCGGGCTGGACTTTGAGACGTTCTTCTCGAGAAGAACGTCTCAAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-434s1c1
Sequence:CCGGGCCTGAAGAGATGAATGTCAACTCGAGTTGACATTCATCTCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-666s1c1
Sequence:CCGGGATGCCAATGGCTGCATCAATCTCGAGATTGATGCAGCCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002841
MYL4 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 4, alkali; atrial, embryonic
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002841.1-480s21c1
Sequence:CCGGCCCATCCTGCAGCACATTTCCCTCGAGGGAAATGTGCTGCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002841.1-539s21c1
Sequence:CCGGGGGCCTGCGTGTCTTTGACAACTCGAGTTGTCAAAGACACGCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002841.1-758s1c1
Sequence:CCGGGCCATACCAGGGTGAGTTAAACTCGAGTTTAACTCACCCTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-458s1c1
Sequence:CCGGGCTGGACTTTGAGACGTTCTTCTCGAGAAGAACGTCTCAAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-434s1c1
Sequence:CCGGGCCTGAAGAGATGAATGTCAACTCGAGTTGACATTCATCTCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002841.1-666s1c1
Sequence:CCGGGATGCCAATGGCTGCATCAATCTCGAGATTGATGCAGCCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010858
MYL4 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 4, alkali; atrial, embryonic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010858.3-759s1c1
Sequence:CCGGCTGCGTGAGAAAGCAAGAGATCTCGAGATCTCTTGCTTTCTCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-553s1c1
Sequence:CCGGCTGCGGGTCTTTGACAAAGAACTCGAGTTCTTTGTCAAAGACCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-554s1c1
Sequence:CCGGTGCGGGTCTTTGACAAAGAAACTCGAGTTTCTTTGTCAAAGACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-320s1c1
Sequence:CCGGCATTGTTTGACCGGACTCCAACTCGAGTTGGAGTCCGGTCAAACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-498s1c1
Sequence:CCGGGCAACACATCTCCCGCAACAACTCGAGTTGTTGCGGGAGATGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010858
MYL4 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 4, alkali; atrial, embryonic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010858.3-759s1c1
Sequence:CCGGCTGCGTGAGAAAGCAAGAGATCTCGAGATCTCTTGCTTTCTCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-553s1c1
Sequence:CCGGCTGCGGGTCTTTGACAAAGAACTCGAGTTCTTTGTCAAAGACCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-554s1c1
Sequence:CCGGTGCGGGTCTTTGACAAAGAAACTCGAGTTTCTTTGTCAAAGACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-320s1c1
Sequence:CCGGCATTGTTTGACCGGACTCCAACTCGAGTTGGAGTCCGGTCAAACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-498s1c1
Sequence:CCGGGCAACACATCTCCCGCAACAACTCGAGTTGTTGCGGGAGATGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010858
MYL4 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 4, alkali; atrial, embryonic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010858.3-759s1c1
Sequence:CCGGCTGCGTGAGAAAGCAAGAGATCTCGAGATCTCTTGCTTTCTCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-553s1c1
Sequence:CCGGCTGCGGGTCTTTGACAAAGAACTCGAGTTCTTTGTCAAAGACCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-554s1c1
Sequence:CCGGTGCGGGTCTTTGACAAAGAAACTCGAGTTTCTTTGTCAAAGACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-320s1c1
Sequence:CCGGCATTGTTTGACCGGACTCCAACTCGAGTTGGAGTCCGGTCAAACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010858.3-498s1c1
Sequence:CCGGGCAACACATCTCCCGCAACAACTCGAGTTGTTGCGGGAGATGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks