EMAIL THIS PAGE TO A FRIEND

MYL7

myosin, light chain 7, regulatory

Synonyms: MYL2A MYLC2A
UniProtKB ID: Q01449, B2R4L3
Gene ID:
Mouse(17898) myosin, light polypeptide 7, regulatory
Rat(289759) myosin, light chain 7, regulatory
Zebrafish(30592) myosin, light polypeptide 7, regulatory
cow(508257) myosin, light chain 7, regulatory
domestic cat(101095326) myosin, light chain 7, regulatory
dog(100683291) myosin, light chain 7, regulatory
naked mole-rat(101721307) myosin, light chain 7, regulatory
sheep(101117156) myosin, light chain 7, regulatory
Gene Class: Calcium_Binding
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021223 Rosetta Predictions human pricing
NM_001106017 Rosetta Predictions rat pricing
NM_022879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025617 predicted 327
2 SASI_Hs01_00025618 predicted 330
3 SASI_Hs01_00025619 predicted 327
4 SASI_Hs01_00025620 predicted 333
5 SASI_Hs01_00025621 predicted 274
6 SASI_Hs01_00025622 predicted 236
7 SASI_Hs01_00025623 predicted 271
8 SASI_Hs01_00025624 predicted 368
9 SASI_Hs01_00025625 predicted 232
10 SASI_Hs01_00025626 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214802 predicted 320
2 SASI_Rn02_00214803 predicted 319
3 SASI_Rn02_00214804 predicted 315
4 SASI_Rn02_00214805 predicted 320
5 SASI_Rn02_00214806 predicted 347
6 SASI_Rn02_00214807 predicted 311
7 SASI_Rn02_00214808 predicted 349
8 SASI_Rn02_00214809 predicted 346
9 SASI_Rn02_00214810 predicted 196
10 SASI_Rn02_00214811 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155727 predicted 253
2 SASI_Mm01_00155728 predicted 208
3 SASI_Mm01_00155729 predicted 331
4 SASI_Mm01_00155730 predicted 242
5 SASI_Mm01_00155731 predicted 330
6 SASI_Mm01_00155732 predicted 208
7 SASI_Mm01_00155733 predicted 257
8 SASI_Mm01_00155734 predicted 215
9 SASI_Mm01_00155735 predicted 251
10 SASI_Mm01_00155736 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021223
MYL7 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 7, regulatory
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021223.2-299s21c1
Sequence:CCGGAGAAGCTCAATGGGACAGACCCTCGAGGGTCTGTCCCATTGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021223.2-383s21c1
Sequence:CCGGAGGATGAGTTCAAGCAGCTTCCTCGAGGAAGCTGCTTGAACTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-70s1c1
Sequence:CCGGCGTGGTTCTTCCAACGTCTTTCTCGAGAAAGACGTTGGAAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-442s1c1
Sequence:CCGGGAGCAGATGTTCGCCCTGACACTCGAGTGTCAGGGCGAACATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-139s1c1
Sequence:CCGGTGTATCGACCAGAATCGTGATCTCGAGATCACGATTCTGGTCGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-333s1c1
Sequence:CCGGCCTGAGTGCCTTCCGCATGTTCTCGAGAACATGCGGAAGGCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-106s1c1
Sequence:CCGGGCCCAGATACAGGAGTTCAAACTCGAGTTTGAACTCCTGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021223
MYL7 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 7, regulatory
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021223.2-299s21c1
Sequence:CCGGAGAAGCTCAATGGGACAGACCCTCGAGGGTCTGTCCCATTGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021223.2-383s21c1
Sequence:CCGGAGGATGAGTTCAAGCAGCTTCCTCGAGGAAGCTGCTTGAACTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-70s1c1
Sequence:CCGGCGTGGTTCTTCCAACGTCTTTCTCGAGAAAGACGTTGGAAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-442s1c1
Sequence:CCGGGAGCAGATGTTCGCCCTGACACTCGAGTGTCAGGGCGAACATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-139s1c1
Sequence:CCGGTGTATCGACCAGAATCGTGATCTCGAGATCACGATTCTGGTCGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-333s1c1
Sequence:CCGGCCTGAGTGCCTTCCGCATGTTCTCGAGAACATGCGGAAGGCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-106s1c1
Sequence:CCGGGCCCAGATACAGGAGTTCAAACTCGAGTTTGAACTCCTGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021223
MYL7 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 7, regulatory
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021223.2-299s21c1
Sequence:CCGGAGAAGCTCAATGGGACAGACCCTCGAGGGTCTGTCCCATTGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021223.2-383s21c1
Sequence:CCGGAGGATGAGTTCAAGCAGCTTCCTCGAGGAAGCTGCTTGAACTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-70s1c1
Sequence:CCGGCGTGGTTCTTCCAACGTCTTTCTCGAGAAAGACGTTGGAAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-442s1c1
Sequence:CCGGGAGCAGATGTTCGCCCTGACACTCGAGTGTCAGGGCGAACATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-139s1c1
Sequence:CCGGTGTATCGACCAGAATCGTGATCTCGAGATCACGATTCTGGTCGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-333s1c1
Sequence:CCGGCCTGAGTGCCTTCCGCATGTTCTCGAGAACATGCGGAAGGCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021223.1-106s1c1
Sequence:CCGGGCCCAGATACAGGAGTTCAAACTCGAGTTTGAACTCCTGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022879
MYL7 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 7, regulatory
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-436s1c1
Sequence:CCGGGCTGAGGTAGAGCAACTGTTTCTCGAGAAACAGTTGCTCTACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-78s1c1
Sequence:CCGGCTCTTCTAATGTCTTCTCAATCTCGAGATTGAGAAGACATTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-67s1c1
Sequence:CCGGGCACAACGTGGCTCTTCTAATCTCGAGATTAGAAGAGCCACGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-160s1c1
Sequence:CCGGGATGGGATCATCTGCAAATCACTCGAGTGATTTGCAGATGATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-88s1c1
Sequence:CCGGGTCTTCTCAATGTTCGAACAACTCGAGTTGTTCGAACATTGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022879
MYL7 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 7, regulatory
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-436s1c1
Sequence:CCGGGCTGAGGTAGAGCAACTGTTTCTCGAGAAACAGTTGCTCTACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-78s1c1
Sequence:CCGGCTCTTCTAATGTCTTCTCAATCTCGAGATTGAGAAGACATTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-67s1c1
Sequence:CCGGGCACAACGTGGCTCTTCTAATCTCGAGATTAGAAGAGCCACGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-160s1c1
Sequence:CCGGGATGGGATCATCTGCAAATCACTCGAGTGATTTGCAGATGATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-88s1c1
Sequence:CCGGGTCTTCTCAATGTTCGAACAACTCGAGTTGTTCGAACATTGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022879
MYL7 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 7, regulatory
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-436s1c1
Sequence:CCGGGCTGAGGTAGAGCAACTGTTTCTCGAGAAACAGTTGCTCTACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-78s1c1
Sequence:CCGGCTCTTCTAATGTCTTCTCAATCTCGAGATTGAGAAGACATTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-67s1c1
Sequence:CCGGGCACAACGTGGCTCTTCTAATCTCGAGATTAGAAGAGCCACGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-160s1c1
Sequence:CCGGGATGGGATCATCTGCAAATCACTCGAGTGATTTGCAGATGATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022879.1-88s1c1
Sequence:CCGGGTCTTCTCAATGTTCGAACAACTCGAGTTGTTCGAACATTGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks