EMAIL THIS PAGE TO A FRIEND

MYL9

myosin, light chain 9, regulatory

Synonyms: LC20 MLC-2C MLC2 MRLC1 MYRL2
UniProtKB ID: P24844, E1P5T6, Q9BQL9, Q9BUF9, Q9H136
Gene ID:
Human(10398) Summary: Myosin, a structural component of muscle, consists of two heavy chains and four light chains. The protein encoded by this gene is a myosin light chain that may regulate muscle contraction by modulating the ATPase activity of myosin heads. The encoded protein binds calcium and is activated by myosin light chain kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(98932) myosin, light polypeptide 9, regulatory
Rat(296313) myosin, light chain 9, regulatory
chicken(396215) myosin, light chain 9, regulatory
cow(505964) myosin, light chain 9, regulatory
domestic cat(101097882) myosin, light chain 9, regulatory
dog(485856) myosin, light chain 9, regulatory
naked mole-rat(101716487) myosin, light chain 9, regulatory
domestic guinea pig(100725728) myosin, light chain 9, regulatory
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006097 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006097 Rosetta Predictions human pricing
NM_181526 Rosetta Predictions human pricing
NM_001100885 Rosetta Predictions rat pricing
XM_485171 Rosetta Predictions mouse pricing
XM_977718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035305 predicted 964
2 SASI_Hs01_00035306 predicted 962
3 SASI_Hs01_00035307 predicted 957
4 SASI_Hs01_00035308 predicted 527
5 SASI_Hs01_00035309 predicted 579
6 SASI_Hs01_00035310 predicted 144
7 SASI_Hs01_00035311 predicted 145
8 SASI_Hs01_00035312 predicted 562
9 SASI_Hs01_00035313 predicted 388
10 SASI_Hs01_00035314 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128966 predicted 795
2 SASI_Hs01_00128967 predicted 803
3 SASI_Hs01_00128968 predicted 793
4 SASI_Hs01_00128969 predicted 371
5 SASI_Hs01_00128970 predicted 418
6 SASI_Hs01_00128971 predicted 152
7 SASI_Hs01_00128972 predicted 140
8 SASI_Hs01_00128973 predicted 402
9 SASI_Hs01_00128974 predicted 203
10 SASI_Hs01_00128975 predicted 149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210692 predicted 431
2 SASI_Rn02_00210693 predicted 735
3 SASI_Rn02_00210694 predicted 640
4 SASI_Rn02_00210695 predicted 684
5 SASI_Rn02_00210696 predicted 428
6 SASI_Rn02_00210697 predicted 630
7 SASI_Rn02_00210698 predicted 534
8 SASI_Rn02_00210699 predicted 462
9 SASI_Rn02_00210700 predicted 735
10 SASI_Rn02_00210701 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239528 predicted 528
2 SASI_Mm02_00426624 predicted 456
3 SASI_Mm01_00239529 predicted 536
4 SASI_Mm01_00239530 predicted 514
5 SASI_Mm02_00426625 predicted 594
6 SASI_Mm01_00239535 predicted 595
7 SASI_Mm01_00239536 predicted 591
8 SASI_Mm02_00426626 predicted 502
9 SASI_Mm02_00426627 predicted 460
10 SASI_Mm02_00426628 predicted 502
11 SASI_Mm01_00239531 predicted 487
12 SASI_Mm01_00239532 predicted 226
13 SASI_Mm01_00239533 predicted 606
14 SASI_Mm01_00239534 predicted 676
15 SASI_Mm01_00239537 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446397 predicted 527
2 SASI_Mm02_00446398 predicted 537
3 SASI_Mm02_00446399 predicted 513
4 SASI_Mm02_00446400 predicted 308
5 SASI_Mm02_00446401 predicted 599
6 SASI_Mm02_00446402 predicted 231
7 SASI_Mm02_00446403 predicted 328
8 SASI_Mm02_00446404 predicted 591
9 SASI_Mm02_00446405 predicted 593
10 SASI_Mm02_00446406 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006097
MYL9 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 9, regulatory
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-395s1c1
Sequence:CCGGGATGTGATTCGCAACGCCTTTCTCGAGAAAGGCGTTGCGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-147s1c1
Sequence:CCGGCCACATCCAATGTCTTCGCAACTCGAGTTGCGAAGACATTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-592s1c1
Sequence:CCGGCGCCAAGGATAAAGACGACTACTCGAGTAGTCGTCTTTATCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-535s1c1
Sequence:CCGGCATTGATAAGAAAGGCAACTTCTCGAGAAGTTGCCTTTCTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-424s1c1
Sequence:CCGGCGACGAGGAAGCCTCAGGTTTCTCGAGAAACCTGAGGCTTCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-147s21c1
Sequence:CCGGCCACATCCAATGTCTTCGCAACTCGAGTTGCGAAGACATTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-592s21c1
Sequence:CCGGCGCCAAGGATAAAGACGACTACTCGAGTAGTCGTCTTTATCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-535s21c1
Sequence:CCGGCATTGATAAGAAAGGCAACTTCTCGAGAAGTTGCCTTTCTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-395s21c1
Sequence:CCGGGATGTGATTCGCAACGCCTTTCTCGAGAAAGGCGTTGCGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006097
MYL9 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 9, regulatory
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-395s1c1
Sequence:CCGGGATGTGATTCGCAACGCCTTTCTCGAGAAAGGCGTTGCGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-147s1c1
Sequence:CCGGCCACATCCAATGTCTTCGCAACTCGAGTTGCGAAGACATTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-592s1c1
Sequence:CCGGCGCCAAGGATAAAGACGACTACTCGAGTAGTCGTCTTTATCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-535s1c1
Sequence:CCGGCATTGATAAGAAAGGCAACTTCTCGAGAAGTTGCCTTTCTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-424s1c1
Sequence:CCGGCGACGAGGAAGCCTCAGGTTTCTCGAGAAACCTGAGGCTTCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-147s21c1
Sequence:CCGGCCACATCCAATGTCTTCGCAACTCGAGTTGCGAAGACATTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-592s21c1
Sequence:CCGGCGCCAAGGATAAAGACGACTACTCGAGTAGTCGTCTTTATCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-535s21c1
Sequence:CCGGCATTGATAAGAAAGGCAACTTCTCGAGAAGTTGCCTTTCTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-395s21c1
Sequence:CCGGGATGTGATTCGCAACGCCTTTCTCGAGAAAGGCGTTGCGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006097
MYL9 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 9, regulatory
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-395s1c1
Sequence:CCGGGATGTGATTCGCAACGCCTTTCTCGAGAAAGGCGTTGCGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-147s1c1
Sequence:CCGGCCACATCCAATGTCTTCGCAACTCGAGTTGCGAAGACATTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-592s1c1
Sequence:CCGGCGCCAAGGATAAAGACGACTACTCGAGTAGTCGTCTTTATCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-535s1c1
Sequence:CCGGCATTGATAAGAAAGGCAACTTCTCGAGAAGTTGCCTTTCTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006097.3-424s1c1
Sequence:CCGGCGACGAGGAAGCCTCAGGTTTCTCGAGAAACCTGAGGCTTCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-147s21c1
Sequence:CCGGCCACATCCAATGTCTTCGCAACTCGAGTTGCGAAGACATTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-592s21c1
Sequence:CCGGCGCCAAGGATAAAGACGACTACTCGAGTAGTCGTCTTTATCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-535s21c1
Sequence:CCGGCATTGATAAGAAAGGCAACTTCTCGAGAAGTTGCCTTTCTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006097.3-395s21c1
Sequence:CCGGGATGTGATTCGCAACGCCTTTCTCGAGAAAGGCGTTGCGAATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172118
VALIDATED
MYL9 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 9, regulatory
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-906s21c1
Sequence:CCGGGTTCTGGTGTCGGACACTAATCTCGAGATTAGTGTCCGACACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-569s21c1
Sequence:CCGGCCAAGGACAAGGACGACTAAGCTCGAGCTTAGTCGTCCTTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-498s21c1
Sequence:CCGGCCGCGAGGCACCCATTGATAACTCGAGTTATCAATGGGTGCCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-542s21c1
Sequence:CCGGAGTTCACTCGCATCCTCAAACCTCGAGGTTTGAGGATGCGAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-271s21c1
Sequence:CCGGGAGTATCTGGAGGGCATGATGCTCGAGCATCATGCCCTCCAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172118
VALIDATED
MYL9 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 9, regulatory
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-906s21c1
Sequence:CCGGGTTCTGGTGTCGGACACTAATCTCGAGATTAGTGTCCGACACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-569s21c1
Sequence:CCGGCCAAGGACAAGGACGACTAAGCTCGAGCTTAGTCGTCCTTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-498s21c1
Sequence:CCGGCCGCGAGGCACCCATTGATAACTCGAGTTATCAATGGGTGCCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-542s21c1
Sequence:CCGGAGTTCACTCGCATCCTCAAACCTCGAGGTTTGAGGATGCGAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-271s21c1
Sequence:CCGGGAGTATCTGGAGGGCATGATGCTCGAGCATCATGCCCTCCAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172118
VALIDATED
MYL9 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 9, regulatory
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-906s21c1
Sequence:CCGGGTTCTGGTGTCGGACACTAATCTCGAGATTAGTGTCCGACACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-569s21c1
Sequence:CCGGCCAAGGACAAGGACGACTAAGCTCGAGCTTAGTCGTCCTTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-498s21c1
Sequence:CCGGCCGCGAGGCACCCATTGATAACTCGAGTTATCAATGGGTGCCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-542s21c1
Sequence:CCGGAGTTCACTCGCATCCTCAAACCTCGAGGTTTGAGGATGCGAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172118.1-271s21c1
Sequence:CCGGGAGTATCTGGAGGGCATGATGCTCGAGCATCATGCCCTCCAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks