EMAIL THIS PAGE TO A FRIEND

MYO10

myosin X

Gene ID:
Human(4651) Summary: This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
Mouse(17909) myosin X
Rat(310178) myosin X
cow(281935) myosin X
Horse(100054475) myosin X
dog(489261) myosin X
chicken(420913) myosin X
sheep(101102178) myosin X
Gene Class: Cytoskeleton
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA024223 Anti-MYO10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012334 Rosetta Predictions human pricing
NM_001107657 Rosetta Predictions rat pricing
NM_019472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245542 predicted 5482
2 SASI_Hs01_00245543 predicted 1331
3 SASI_Hs02_00344123 predicted 5148
4 SASI_Hs01_00245544 predicted 4743
5 SASI_Hs01_00245545 predicted 2169
6 SASI_Hs02_00344124 predicted 1393
7 SASI_Hs01_00245546 predicted 6566
8 SASI_Hs01_00245547 predicted 6487
9 SASI_Hs01_00245548 predicted 2247
10 SASI_Hs01_00245549 predicted 4507
11 SASI_Hs01_00245550 predicted 2152
12 SASI_Hs01_00245551 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230985 predicted 1702
2 SASI_Rn02_00230986 predicted 6401
3 SASI_Rn02_00230987 predicted 5267
4 SASI_Rn02_00230988 predicted 6541
5 SASI_Rn02_00230989 predicted 1651
6 SASI_Rn02_00230990 predicted 2164
7 SASI_Rn02_00230991 predicted 4476
8 SASI_Rn02_00230992 predicted 5783
9 SASI_Rn02_00230993 predicted 5139
10 SASI_Rn02_00230994 predicted 3977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195523 predicted 5478
2 SASI_Mm01_00195524 predicted 1366
3 SASI_Mm02_00324472 predicted 6432
4 SASI_Mm01_00195526 predicted 4507
5 SASI_Mm01_00195527 predicted 582
6 SASI_Mm02_00324473 predicted 1166
7 SASI_Mm02_00324474 predicted 2311
8 SASI_Mm02_00324475 predicted 1670
9 SASI_Mm01_00195530 predicted 4772
10 SASI_Mm01_00195531 predicted 6055
11 SASI_Mm01_00195522 predicted 5309
12 SASI_Mm01_00195525 predicted 792
13 SASI_Mm01_00195528 predicted 1363
14 SASI_Mm01_00195529 predicted 5443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012334
VALIDATED
MYO10 MISSION shRNA Bacterial Glycerol Stock
myosin X
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012334.1-6560s1c1
Sequence:CCGGCCGCCTTCATTGATCCTGTATCTCGAGATACAGGATCAATGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-4578s1c1
Sequence:CCGGCCCAGATGAGAAGATATTCAACTCGAGTTGAATATCTTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-4075s1c1
Sequence:CCGGGATAGGACTTTCCACCTGATTCTCGAGAATCAGGTGGAAAGTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-5046s1c1
Sequence:CCGGCCAGCTTATCAAACAGACCAACTCGAGTTGGTCTGTTTGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012334.1-2387s1c1
Sequence:CCGGCCAAGGTCTTTCTTCGAGAATCTCGAGATTCTCGAAGAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-2633s21c1
Sequence:CCGGCCAAGGTCTTTCTTCGAGAATCTCGAGATTCTCGAAGAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012334.2-4824s21c1
Sequence:CCGGCCCAGATGAGAAGATATTCAACTCGAGTTGAATATCTTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-4321s21c1
Sequence:CCGGGATAGGACTTTCCACCTGATTCTCGAGAATCAGGTGGAAAGTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-7061s21c1
Sequence:CCGGACTAACCTCCCAACCTGATTTCTCGAGAAATCAGGTTGGGAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012334
VALIDATED
MYO10 MISSION shRNA shRNA Plasmid DNA
myosin X
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012334.1-6560s1c1
Sequence:CCGGCCGCCTTCATTGATCCTGTATCTCGAGATACAGGATCAATGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-4578s1c1
Sequence:CCGGCCCAGATGAGAAGATATTCAACTCGAGTTGAATATCTTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-4075s1c1
Sequence:CCGGGATAGGACTTTCCACCTGATTCTCGAGAATCAGGTGGAAAGTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-5046s1c1
Sequence:CCGGCCAGCTTATCAAACAGACCAACTCGAGTTGGTCTGTTTGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012334.1-2387s1c1
Sequence:CCGGCCAAGGTCTTTCTTCGAGAATCTCGAGATTCTCGAAGAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-2633s21c1
Sequence:CCGGCCAAGGTCTTTCTTCGAGAATCTCGAGATTCTCGAAGAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012334.2-4824s21c1
Sequence:CCGGCCCAGATGAGAAGATATTCAACTCGAGTTGAATATCTTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-4321s21c1
Sequence:CCGGGATAGGACTTTCCACCTGATTCTCGAGAATCAGGTGGAAAGTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-7061s21c1
Sequence:CCGGACTAACCTCCCAACCTGATTTCTCGAGAAATCAGGTTGGGAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012334
VALIDATED
MYO10 MISSION shRNA Lentiviral Transduction Particles
myosin X
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012334.1-6560s1c1
Sequence:CCGGCCGCCTTCATTGATCCTGTATCTCGAGATACAGGATCAATGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-4578s1c1
Sequence:CCGGCCCAGATGAGAAGATATTCAACTCGAGTTGAATATCTTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-4075s1c1
Sequence:CCGGGATAGGACTTTCCACCTGATTCTCGAGAATCAGGTGGAAAGTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012334.1-5046s1c1
Sequence:CCGGCCAGCTTATCAAACAGACCAACTCGAGTTGGTCTGTTTGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012334.1-2387s1c1
Sequence:CCGGCCAAGGTCTTTCTTCGAGAATCTCGAGATTCTCGAAGAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-2633s21c1
Sequence:CCGGCCAAGGTCTTTCTTCGAGAATCTCGAGATTCTCGAAGAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012334.2-4824s21c1
Sequence:CCGGCCCAGATGAGAAGATATTCAACTCGAGTTGAATATCTTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-4321s21c1
Sequence:CCGGGATAGGACTTTCCACCTGATTCTCGAGAATCAGGTGGAAAGTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012334.2-7061s21c1
Sequence:CCGGACTAACCTCCCAACCTGATTTCTCGAGAAATCAGGTTGGGAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019472
VALIDATED
MYO10 MISSION shRNA Bacterial Glycerol Stock
myosin X
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-2343s1c1
Sequence:CCGGCTTAGGCTACTTGGCACGAAACTCGAGTTTCGTGCCAAGTAGCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-5499s1c1
Sequence:CCGGCGTGGAGTTTGCGTTTATGTTCTCGAGAACATAAACGCAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-6115s1c1
Sequence:CCGGGCCAACACGTACAAGATCGTACTCGAGTACGATCTTGTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-487s1c1
Sequence:CCGGGCCATTGCCAACGAATGCTATCTCGAGATAGCATTCGTTGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-2205s1c1
Sequence:CCGGGCAGGTCTATGACGCTTCTAACTCGAGTTAGAAGCGTCATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-6588s21c1
Sequence:CCGGTGATTGTGAAGAAGCGCTATACTCGAGTATAGCGCTTCTTCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-5979s21c1
Sequence:CCGGAGTATCTGCAGGGCGACTATACTCGAGTATAGTCGCCCTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019472.2-3986s21c1
Sequence:CCGGTGCGTCACACTGCCCTATTTCCTCGAGGAAATAGGGCAGTGTGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-6562s21c1
Sequence:CCGGCAAGCTCATGAAAGCGTATATCTCGAGATATACGCTTTCATGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019472.2-863s21c1
Sequence:CCGGGCCATTGCCAACGAATGCTATCTCGAGATAGCATTCGTTGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-3740s21c1
Sequence:CCGGGACTATGACCAGGACGATTACCTCGAGGTAATCGTCCTGGTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019472
VALIDATED
MYO10 MISSION shRNA shRNA Plasmid DNA
myosin X
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-2343s1c1
Sequence:CCGGCTTAGGCTACTTGGCACGAAACTCGAGTTTCGTGCCAAGTAGCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-5499s1c1
Sequence:CCGGCGTGGAGTTTGCGTTTATGTTCTCGAGAACATAAACGCAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-6115s1c1
Sequence:CCGGGCCAACACGTACAAGATCGTACTCGAGTACGATCTTGTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-487s1c1
Sequence:CCGGGCCATTGCCAACGAATGCTATCTCGAGATAGCATTCGTTGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-2205s1c1
Sequence:CCGGGCAGGTCTATGACGCTTCTAACTCGAGTTAGAAGCGTCATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-6588s21c1
Sequence:CCGGTGATTGTGAAGAAGCGCTATACTCGAGTATAGCGCTTCTTCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-5979s21c1
Sequence:CCGGAGTATCTGCAGGGCGACTATACTCGAGTATAGTCGCCCTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019472.2-3986s21c1
Sequence:CCGGTGCGTCACACTGCCCTATTTCCTCGAGGAAATAGGGCAGTGTGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-6562s21c1
Sequence:CCGGCAAGCTCATGAAAGCGTATATCTCGAGATATACGCTTTCATGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019472.2-863s21c1
Sequence:CCGGGCCATTGCCAACGAATGCTATCTCGAGATAGCATTCGTTGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-3740s21c1
Sequence:CCGGGACTATGACCAGGACGATTACCTCGAGGTAATCGTCCTGGTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019472
VALIDATED
MYO10 MISSION shRNA Lentiviral Transduction Particles
myosin X
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-2343s1c1
Sequence:CCGGCTTAGGCTACTTGGCACGAAACTCGAGTTTCGTGCCAAGTAGCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-5499s1c1
Sequence:CCGGCGTGGAGTTTGCGTTTATGTTCTCGAGAACATAAACGCAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-6115s1c1
Sequence:CCGGGCCAACACGTACAAGATCGTACTCGAGTACGATCTTGTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-487s1c1
Sequence:CCGGGCCATTGCCAACGAATGCTATCTCGAGATAGCATTCGTTGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019472.1-2205s1c1
Sequence:CCGGGCAGGTCTATGACGCTTCTAACTCGAGTTAGAAGCGTCATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-6588s21c1
Sequence:CCGGTGATTGTGAAGAAGCGCTATACTCGAGTATAGCGCTTCTTCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-5979s21c1
Sequence:CCGGAGTATCTGCAGGGCGACTATACTCGAGTATAGTCGCCCTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019472.2-3986s21c1
Sequence:CCGGTGCGTCACACTGCCCTATTTCCTCGAGGAAATAGGGCAGTGTGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-6562s21c1
Sequence:CCGGCAAGCTCATGAAAGCGTATATCTCGAGATATACGCTTTCATGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019472.2-863s21c1
Sequence:CCGGGCCATTGCCAACGAATGCTATCTCGAGATAGCATTCGTTGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019472.2-3740s21c1
Sequence:CCGGGACTATGACCAGGACGATTACCTCGAGGTAATCGTCCTGGTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks