EMAIL THIS PAGE TO A FRIEND
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012223 Rosetta Predictions human pricing
NM_053986 Rosetta Predictions rat pricing
NM_010863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111059 predicted 2135
2 SASI_Hs01_00111060 predicted 1502
3 SASI_Hs02_00343897 predicted 476
4 SASI_Hs01_00111061 predicted 3229
5 SASI_Hs01_00111062 predicted 2760
6 SASI_Hs01_00111063 predicted 2918
7 SASI_Hs01_00111064 predicted 1332
8 SASI_Hs01_00111066 predicted 2477
9 SASI_Hs01_00111067 predicted 1813
10 SASI_Hs02_00343898 predicted 494
11 SASI_Hs01_00111065 predicted 1995
12 SASI_Hs01_00111068 predicted 2614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110354 predicted 1157
2 SASI_Rn01_00110356 predicted 2332
3 SASI_Rn01_00110357 predicted 1266
4 SASI_Rn01_00110358 predicted 687
5 SASI_Rn01_00110359 predicted 209
6 SASI_Rn01_00110360 predicted 2833
7 SASI_Rn01_00110361 predicted 3362
8 SASI_Rn01_00110362 predicted 2045
9 SASI_Rn01_00110363 predicted 1465
10 SASI_Rn02_00266983 predicted 1234
11 SASI_Rn01_00110355 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103777 predicted 1054
2 SASI_Mm01_00103778 predicted 376
3 SASI_Mm01_00103779 predicted 1400
4 SASI_Mm01_00103780 predicted 2711
5 SASI_Mm01_00103781 predicted 747
6 SASI_Mm01_00103782 predicted 2983
7 SASI_Mm01_00103783 predicted 492
8 SASI_Mm02_00319528 predicted 2643
9 SASI_Mm02_00319529 predicted 1432
10 SASI_Mm02_00319530 predicted 1492
11 SASI_Mm01_00103776 predicted 688
12 SASI_Mm01_00103784 predicted 913
13 SASI_Mm01_00103785 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012223
VALIDATED
MYO1B MISSION shRNA Bacterial Glycerol Stock
myosin IB
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012223.3-2603s21c1
Sequence:CCGGTCACGACCATTGCTGCATATTCTCGAGAATATGCAGCAATGGTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012223.3-1583s21c1
Sequence:CCGGCTATCATTTGTGACCTAATAGCTCGAGCTATTAGGTCACAAATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012223.2-4084s1c1
Sequence:CCGGCCAGGTTAAATCCCTCTACATCTCGAGATGTAGAGGGATTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-1999s1c1
Sequence:CCGGCCCAAACTATATTAGGTGTATCTCGAGATACACCTAATATAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_012223.2-2491s1c1
Sequence:CCGGCGCCTTAGTAATTCAGTCTTACTCGAGTAAGACTGAATTACTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-1002s1c1
Sequence:CCGGCCATGCAGATTGTGGGCTTTACTCGAGTAAAGCCCACAATCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-2490s1c1
Sequence:CCGGCCGCCTTAGTAATTCAGTCTTCTCGAGAAGACTGAATTACTAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012223
VALIDATED
MYO1B MISSION shRNA shRNA Plasmid DNA
myosin IB
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012223.3-2603s21c1
Sequence:CCGGTCACGACCATTGCTGCATATTCTCGAGAATATGCAGCAATGGTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012223.3-1583s21c1
Sequence:CCGGCTATCATTTGTGACCTAATAGCTCGAGCTATTAGGTCACAAATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012223.2-4084s1c1
Sequence:CCGGCCAGGTTAAATCCCTCTACATCTCGAGATGTAGAGGGATTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-1999s1c1
Sequence:CCGGCCCAAACTATATTAGGTGTATCTCGAGATACACCTAATATAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_012223.2-2491s1c1
Sequence:CCGGCGCCTTAGTAATTCAGTCTTACTCGAGTAAGACTGAATTACTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-1002s1c1
Sequence:CCGGCCATGCAGATTGTGGGCTTTACTCGAGTAAAGCCCACAATCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-2490s1c1
Sequence:CCGGCCGCCTTAGTAATTCAGTCTTCTCGAGAAGACTGAATTACTAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012223
VALIDATED
MYO1B MISSION shRNA Lentiviral Transduction Particles
myosin IB
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012223.3-2603s21c1
Sequence:CCGGTCACGACCATTGCTGCATATTCTCGAGAATATGCAGCAATGGTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012223.3-1583s21c1
Sequence:CCGGCTATCATTTGTGACCTAATAGCTCGAGCTATTAGGTCACAAATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012223.2-4084s1c1
Sequence:CCGGCCAGGTTAAATCCCTCTACATCTCGAGATGTAGAGGGATTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-1999s1c1
Sequence:CCGGCCCAAACTATATTAGGTGTATCTCGAGATACACCTAATATAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_012223.2-2491s1c1
Sequence:CCGGCGCCTTAGTAATTCAGTCTTACTCGAGTAAGACTGAATTACTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-1002s1c1
Sequence:CCGGCCATGCAGATTGTGGGCTTTACTCGAGTAAAGCCCACAATCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012223.2-2490s1c1
Sequence:CCGGCCGCCTTAGTAATTCAGTCTTCTCGAGAAGACTGAATTACTAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010863
VALIDATED
MYO1B MISSION shRNA Bacterial Glycerol Stock
myosin IB
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-396s21c1
Sequence:CCGGGCCGGAGAAAGTGGAAGATTACTCGAGTAATCTTCCACTTTCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-1168s21c1
Sequence:CCGGGCGTTCAGTTTCCGAACAGTTCTCGAGAACTGTTCGGAAACTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010863.2-3626s21c1
Sequence:CCGGGCTAACTGTTAGCGTCCTCTTCTCGAGAAGAGGACGCTAACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-3321s21c1
Sequence:CCGGCCTGATTGAAATGGCAACCAACTCGAGTTGGTTGCCATTTCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-2324s21c1
Sequence:CCGGCCACTCTCATTCAGAAGATTTCTCGAGAAATCTTCTGAATGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-3537s1c1
Sequence:CCGGGCTAACTGTTAGCGTCCTCTTCTCGAGAAGAGGACGCTAACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-2322s1c1
Sequence:CCGGCCACTCTCATTCAGAAGATTTCTCGAGAAATCTTCTGAATGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-1166s1c1
Sequence:CCGGGCGTTCAGTTTCCGAACAGTTCTCGAGAACTGTTCGGAAACTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-391s1c1
Sequence:CCGGGCCGGAGAAAGTGGAAGATTACTCGAGTAATCTTCCACTTTCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-3232s1c1
Sequence:CCGGCCTGATTGAAATGGCAACCAACTCGAGTTGGTTGCCATTTCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010863
VALIDATED
MYO1B MISSION shRNA shRNA Plasmid DNA
myosin IB
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-396s21c1
Sequence:CCGGGCCGGAGAAAGTGGAAGATTACTCGAGTAATCTTCCACTTTCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-1168s21c1
Sequence:CCGGGCGTTCAGTTTCCGAACAGTTCTCGAGAACTGTTCGGAAACTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010863.2-3626s21c1
Sequence:CCGGGCTAACTGTTAGCGTCCTCTTCTCGAGAAGAGGACGCTAACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-3321s21c1
Sequence:CCGGCCTGATTGAAATGGCAACCAACTCGAGTTGGTTGCCATTTCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-2324s21c1
Sequence:CCGGCCACTCTCATTCAGAAGATTTCTCGAGAAATCTTCTGAATGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-3537s1c1
Sequence:CCGGGCTAACTGTTAGCGTCCTCTTCTCGAGAAGAGGACGCTAACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-2322s1c1
Sequence:CCGGCCACTCTCATTCAGAAGATTTCTCGAGAAATCTTCTGAATGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-1166s1c1
Sequence:CCGGGCGTTCAGTTTCCGAACAGTTCTCGAGAACTGTTCGGAAACTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-391s1c1
Sequence:CCGGGCCGGAGAAAGTGGAAGATTACTCGAGTAATCTTCCACTTTCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-3232s1c1
Sequence:CCGGCCTGATTGAAATGGCAACCAACTCGAGTTGGTTGCCATTTCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010863
VALIDATED
MYO1B MISSION shRNA Lentiviral Transduction Particles
myosin IB
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-396s21c1
Sequence:CCGGGCCGGAGAAAGTGGAAGATTACTCGAGTAATCTTCCACTTTCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-1168s21c1
Sequence:CCGGGCGTTCAGTTTCCGAACAGTTCTCGAGAACTGTTCGGAAACTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010863.2-3626s21c1
Sequence:CCGGGCTAACTGTTAGCGTCCTCTTCTCGAGAAGAGGACGCTAACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-3321s21c1
Sequence:CCGGCCTGATTGAAATGGCAACCAACTCGAGTTGGTTGCCATTTCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010863.2-2324s21c1
Sequence:CCGGCCACTCTCATTCAGAAGATTTCTCGAGAAATCTTCTGAATGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-3537s1c1
Sequence:CCGGGCTAACTGTTAGCGTCCTCTTCTCGAGAAGAGGACGCTAACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-2322s1c1
Sequence:CCGGCCACTCTCATTCAGAAGATTTCTCGAGAAATCTTCTGAATGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-1166s1c1
Sequence:CCGGGCGTTCAGTTTCCGAACAGTTCTCGAGAACTGTTCGGAAACTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-391s1c1
Sequence:CCGGGCCGGAGAAAGTGGAAGATTACTCGAGTAATCTTCCACTTTCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010863.1-3232s1c1
Sequence:CCGGCCTGATTGAAATGGCAACCAACTCGAGTTGGTTGCCATTTCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks