EMAIL THIS PAGE TO A FRIEND

MYO1F

myosin IF

UniProtKB ID: O00160, Q8WWN7
Gene Class: Cytoskeleton
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012335 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012335 Rosetta Predictions human pricing
NM_001108076 Rosetta Predictions rat pricing
NM_053214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019953 predicted 1907
2 SASI_Hs01_00019954 predicted 534
3 SASI_Hs01_00019955 predicted 1342
4 SASI_Hs01_00019956 predicted 3286
5 SASI_Hs01_00019958 predicted 2725
6 SASI_Hs01_00019959 predicted 1993
7 SASI_Hs01_00019960 predicted 958
8 SASI_Hs01_00019961 predicted 667
9 SASI_Hs02_00344125 predicted 241
10 SASI_Hs02_00344126 predicted 381
11 SASI_Hs01_00019952 predicted 3483
12 SASI_Hs01_00019957 predicted 3501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235114 predicted 749
2 SASI_Rn02_00235115 predicted 427
3 SASI_Rn02_00235116 predicted 1016
4 SASI_Rn02_00235117 predicted 2018
5 SASI_Rn02_00235118 predicted 2686
6 SASI_Rn02_00235119 predicted 589
7 SASI_Rn02_00235120 predicted 1874
8 SASI_Rn02_00235121 predicted 345
9 SASI_Rn02_00235122 predicted 3433
10 SASI_Rn02_00235123 predicted 2441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103522 predicted 408
2 SASI_Mm01_00103523 predicted 1008
3 SASI_Mm01_00103524 predicted 3141
4 SASI_Mm01_00103525 predicted 1930
5 SASI_Mm01_00103526 predicted 2752
6 SASI_Mm01_00103527 predicted 3040
7 SASI_Mm01_00103529 predicted 1495
8 SASI_Mm01_00103530 predicted 1197
9 SASI_Mm01_00103531 predicted 346
10 SASI_Mm02_00337795 predicted 2014
11 SASI_Mm01_00103528 predicted 2890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053214
MYO1F MISSION shRNA Bacterial Glycerol Stock
myosin IF
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000448060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053214.2-2465s21c1
Sequence:CCGGGCCGCTTCAAGCCTATCAAACCTCGAGGTTTGATAGGCTTGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053214.2-551s21c1
Sequence:CCGGACAAGGTCCAGCACGTCAAAGCTCGAGCTTTGACGTGCTGGACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053214.1-3617s1c1
Sequence:CCGGCTTGCTATCTAAGTCTCCATTCTCGAGAATGGAGACTTAGATAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-2983s1c1
Sequence:CCGGCCCAGAGGTTTGAATCGAAATCTCGAGATTTCGATTCAAACCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-326s1c1
Sequence:CCGGCCTACTTCACTGACCGAGAAACTCGAGTTTCTCGGTCAGTGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-1102s1c1
Sequence:CCGGAGCCGTAAGATGGACAGCAAACTCGAGTTTGCTGTCCATCTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-1103s1c1
Sequence:CCGGGCCGTAAGATGGACAGCAAATCTCGAGATTTGCTGTCCATCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053214
MYO1F MISSION shRNA shRNA Plasmid DNA
myosin IF
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000448060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053214.2-2465s21c1
Sequence:CCGGGCCGCTTCAAGCCTATCAAACCTCGAGGTTTGATAGGCTTGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053214.2-551s21c1
Sequence:CCGGACAAGGTCCAGCACGTCAAAGCTCGAGCTTTGACGTGCTGGACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053214.1-3617s1c1
Sequence:CCGGCTTGCTATCTAAGTCTCCATTCTCGAGAATGGAGACTTAGATAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-2983s1c1
Sequence:CCGGCCCAGAGGTTTGAATCGAAATCTCGAGATTTCGATTCAAACCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-326s1c1
Sequence:CCGGCCTACTTCACTGACCGAGAAACTCGAGTTTCTCGGTCAGTGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-1102s1c1
Sequence:CCGGAGCCGTAAGATGGACAGCAAACTCGAGTTTGCTGTCCATCTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-1103s1c1
Sequence:CCGGGCCGTAAGATGGACAGCAAATCTCGAGATTTGCTGTCCATCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053214
MYO1F MISSION shRNA Lentiviral Transduction Particles
myosin IF
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000448060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053214.2-2465s21c1
Sequence:CCGGGCCGCTTCAAGCCTATCAAACCTCGAGGTTTGATAGGCTTGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053214.2-551s21c1
Sequence:CCGGACAAGGTCCAGCACGTCAAAGCTCGAGCTTTGACGTGCTGGACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053214.1-3617s1c1
Sequence:CCGGCTTGCTATCTAAGTCTCCATTCTCGAGAATGGAGACTTAGATAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-2983s1c1
Sequence:CCGGCCCAGAGGTTTGAATCGAAATCTCGAGATTTCGATTCAAACCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-326s1c1
Sequence:CCGGCCTACTTCACTGACCGAGAAACTCGAGTTTCTCGGTCAGTGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-1102s1c1
Sequence:CCGGAGCCGTAAGATGGACAGCAAACTCGAGTTTGCTGTCCATCTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053214.1-1103s1c1
Sequence:CCGGGCCGTAAGATGGACAGCAAATCTCGAGATTTGCTGTCCATCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012335
MYO1F MISSION shRNA Bacterial Glycerol Stock
myosin IF
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2649s1c1
Sequence:CCGGCGTCTTCAAGACCGAGTTTGTCTCGAGACAAACTCGGTCTTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2182s1c1
Sequence:CCGGGAGCGAAAGTTCGATGGCTTTCTCGAGAAAGCCATCGAACTTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-266s1c1
Sequence:CCGGGCTCTGTGCTCATCTCTGTAACTCGAGTTACAGAGATGAGCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2733s1c1
Sequence:CCGGCACACTACAGTTTCGGGTGAACTCGAGTTCACCCGAAACTGTAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-169s1c1
Sequence:CCGGGTGGATGACATGGTGCTTCTTCTCGAGAAGAAGCACCATGTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-1996s1c1
Sequence:CCGGGCCAAATTCCTGCAGAGGTATCTCGAGATACCTCTGCAGGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-2526s1c1
Sequence:CCGGCCAGGTGTGTGAAGTCTTGAACTCGAGTTCAAGACTTCACACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2310s1c1
Sequence:CCGGCAACAGCATCAATCGGAACTTCTCGAGAAGTTCCGATTGATGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012335.2-3690s1c1
Sequence:CCGGCCATGTGATTAAGAAATGGGTCTCGAGACCCATTTCTTAATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012335
MYO1F MISSION shRNA shRNA Plasmid DNA
myosin IF
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2649s1c1
Sequence:CCGGCGTCTTCAAGACCGAGTTTGTCTCGAGACAAACTCGGTCTTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2182s1c1
Sequence:CCGGGAGCGAAAGTTCGATGGCTTTCTCGAGAAAGCCATCGAACTTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-266s1c1
Sequence:CCGGGCTCTGTGCTCATCTCTGTAACTCGAGTTACAGAGATGAGCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2733s1c1
Sequence:CCGGCACACTACAGTTTCGGGTGAACTCGAGTTCACCCGAAACTGTAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-169s1c1
Sequence:CCGGGTGGATGACATGGTGCTTCTTCTCGAGAAGAAGCACCATGTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-1996s1c1
Sequence:CCGGGCCAAATTCCTGCAGAGGTATCTCGAGATACCTCTGCAGGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-2526s1c1
Sequence:CCGGCCAGGTGTGTGAAGTCTTGAACTCGAGTTCAAGACTTCACACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2310s1c1
Sequence:CCGGCAACAGCATCAATCGGAACTTCTCGAGAAGTTCCGATTGATGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012335.2-3690s1c1
Sequence:CCGGCCATGTGATTAAGAAATGGGTCTCGAGACCCATTTCTTAATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012335
MYO1F MISSION shRNA Lentiviral Transduction Particles
myosin IF
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2649s1c1
Sequence:CCGGCGTCTTCAAGACCGAGTTTGTCTCGAGACAAACTCGGTCTTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2182s1c1
Sequence:CCGGGAGCGAAAGTTCGATGGCTTTCTCGAGAAAGCCATCGAACTTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-266s1c1
Sequence:CCGGGCTCTGTGCTCATCTCTGTAACTCGAGTTACAGAGATGAGCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2733s1c1
Sequence:CCGGCACACTACAGTTTCGGGTGAACTCGAGTTCACCCGAAACTGTAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-169s1c1
Sequence:CCGGGTGGATGACATGGTGCTTCTTCTCGAGAAGAAGCACCATGTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-1996s1c1
Sequence:CCGGGCCAAATTCCTGCAGAGGTATCTCGAGATACCTCTGCAGGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012335.2-2526s1c1
Sequence:CCGGCCAGGTGTGTGAAGTCTTGAACTCGAGTTCAAGACTTCACACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012335.2-2310s1c1
Sequence:CCGGCAACAGCATCAATCGGAACTTCTCGAGAAGTTCCGATTGATGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012335.2-3690s1c1
Sequence:CCGGCCATGTGATTAAGAAATGGGTCTCGAGACCCATTTCTTAATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks