EMAIL THIS PAGE TO A FRIEND

MYO1G

myosin IG

Synonyms: HA2 MHAG
UniProtKB ID: B0I1T2, Q8TEI9, Q8TES2, Q96BE2, Q96RI5, Q96RI6
Gene ID:
Human(64005) Summary: MYO1G is a plasma membrane-associated class I myosin (see MIM 601478) that is abundant in T and B lymphocytes and mast cells (Pierce et al., 2001 [PubMed 11544309]
Mouse(246177) myosin IG
Rat(289785) myosin IG
sheep(101114605) myosin IG
chicken(420412) myosin IG
cow(516513) myosin IG
Horse(100052077) myosin IG
dog(608648) myosin IG
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA021252 Anti-MYO1G antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033054 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033054 Rosetta Predictions human pricing
NM_001134843 Rosetta Predictions rat pricing
XM_001069724 Rosetta Predictions rat pricing
NM_178440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157251 predicted 2652
2 SASI_Hs01_00157252 predicted 1888
3 SASI_Hs02_00360746 predicted 1189
4 SASI_Hs02_00360747 predicted 811
5 SASI_Hs01_00157253 predicted 2038
6 SASI_Hs01_00157254 predicted 1614
7 SASI_Hs01_00157256 predicted 2048
8 SASI_Hs01_00157257 predicted 1324
9 SASI_Hs01_00157258 predicted 1212
10 SASI_Hs01_00157259 predicted 2339
11 SASI_Hs01_00157255 predicted 441
12 SASI_Hs01_00157260 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258694 predicted 1454
2 SASI_Rn02_00258695 predicted 924
3 SASI_Rn02_00258696 predicted 943
4 SASI_Rn02_00258697 predicted 865
5 SASI_Rn02_00258698 predicted 1295
6 SASI_Rn02_00258699 predicted 1586
7 SASI_Rn02_00258700 predicted 1608
8 SASI_Rn02_00258701 predicted 1854
9 SASI_Rn02_00258702 predicted 2237
10 SASI_Rn02_00258703 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329048 predicted 1620
2 SASI_Rn02_00329049 predicted 1085
3 SASI_Rn02_00329050 predicted 1107
4 SASI_Rn02_00329051 predicted 1035
5 SASI_Rn02_00329052 predicted 1456
6 SASI_Rn02_00329053 predicted 1753
7 SASI_Rn02_00329054 predicted 1768
8 SASI_Rn02_00329055 predicted 2018
9 SASI_Rn02_00329056 predicted 2402
10 SASI_Rn02_00329057 predicted 2638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190769 predicted 2069
2 SASI_Mm01_00190770 predicted 1921
3 SASI_Mm01_00190771 predicted 2892
4 SASI_Mm01_00190772 predicted 822
5 SASI_Mm01_00190773 predicted 2252
6 SASI_Mm02_00348893 predicted 1602
7 SASI_Mm01_00190774 predicted 2944
8 SASI_Mm01_00190775 predicted 208
9 SASI_Mm01_00190776 predicted 1615
10 SASI_Mm01_00190778 predicted 2243
11 SASI_Mm01_00190777 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033054
MYO1G MISSION shRNA Bacterial Glycerol Stock
myosin IG
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2661s1c1
Sequence:CCGGCCTGTTTGCTCAGCGACTAAACTCGAGTTTAGTCGCTGAGCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1212s1c1
Sequence:CCGGGAACAGGATCAACAGTGTCATCTCGAGATGACACTGTTGATCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1434s1c1
Sequence:CCGGGCAGAGCGTTGAGTATTTCAACTCGAGTTGAAATACTCAACGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2307s1c1
Sequence:CCGGGAGGGCTATCTACACCATCATCTCGAGATGATGGTGTAGATAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-137s1c1
Sequence:CCGGGCAAACCTGACTTTGTGCTTTCTCGAGAAAGCACAAAGTCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2668s1c1
Sequence:CCGGGCTCAGCGACTAAAGACACTTCTCGAGAAGTGTCTTTAGTCGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1368s1c1
Sequence:CCGGGCAGCTATTCATCCAGCTCATCTCGAGATGAGCTGGATGAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033054.2-1573s21c1
Sequence:CCGGACCATCACTGACCGAATCTTCCTCGAGGAAGATTCGGTCAGTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033054.2-2663s21c1
Sequence:CCGGTGTCCTCTGCCACTGACAATCCTCGAGGATTGTCAGTGGCAGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033054
MYO1G MISSION shRNA shRNA Plasmid DNA
myosin IG
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2661s1c1
Sequence:CCGGCCTGTTTGCTCAGCGACTAAACTCGAGTTTAGTCGCTGAGCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1212s1c1
Sequence:CCGGGAACAGGATCAACAGTGTCATCTCGAGATGACACTGTTGATCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1434s1c1
Sequence:CCGGGCAGAGCGTTGAGTATTTCAACTCGAGTTGAAATACTCAACGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2307s1c1
Sequence:CCGGGAGGGCTATCTACACCATCATCTCGAGATGATGGTGTAGATAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-137s1c1
Sequence:CCGGGCAAACCTGACTTTGTGCTTTCTCGAGAAAGCACAAAGTCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2668s1c1
Sequence:CCGGGCTCAGCGACTAAAGACACTTCTCGAGAAGTGTCTTTAGTCGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1368s1c1
Sequence:CCGGGCAGCTATTCATCCAGCTCATCTCGAGATGAGCTGGATGAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033054.2-1573s21c1
Sequence:CCGGACCATCACTGACCGAATCTTCCTCGAGGAAGATTCGGTCAGTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033054.2-2663s21c1
Sequence:CCGGTGTCCTCTGCCACTGACAATCCTCGAGGATTGTCAGTGGCAGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033054
MYO1G MISSION shRNA Lentiviral Transduction Particles
myosin IG
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2661s1c1
Sequence:CCGGCCTGTTTGCTCAGCGACTAAACTCGAGTTTAGTCGCTGAGCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1212s1c1
Sequence:CCGGGAACAGGATCAACAGTGTCATCTCGAGATGACACTGTTGATCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1434s1c1
Sequence:CCGGGCAGAGCGTTGAGTATTTCAACTCGAGTTGAAATACTCAACGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2307s1c1
Sequence:CCGGGAGGGCTATCTACACCATCATCTCGAGATGATGGTGTAGATAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-137s1c1
Sequence:CCGGGCAAACCTGACTTTGTGCTTTCTCGAGAAAGCACAAAGTCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-2668s1c1
Sequence:CCGGGCTCAGCGACTAAAGACACTTCTCGAGAAGTGTCTTTAGTCGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033054.1-1368s1c1
Sequence:CCGGGCAGCTATTCATCCAGCTCATCTCGAGATGAGCTGGATGAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033054.2-1573s21c1
Sequence:CCGGACCATCACTGACCGAATCTTCCTCGAGGAAGATTCGGTCAGTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033054.2-2663s21c1
Sequence:CCGGTGTCCTCTGCCACTGACAATCCTCGAGGATTGTCAGTGGCAGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178440
MYO1G MISSION shRNA Bacterial Glycerol Stock
myosin IG
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-954s1c1
Sequence:CCGGCGCCATATTACACCTGGGAAACTCGAGTTTCCCAGGTGTAATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-2920s1c1
Sequence:CCGGGCCCAAGGCTATGATGATCTTCTCGAGAAGATCATCATAGCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-953s1c1
Sequence:CCGGCCGCCATATTACACCTGGGAACTCGAGTTCCCAGGTGTAATATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-2683s1c1
Sequence:CCGGGCTGAGCAACTAAAGGCACTTCTCGAGAAGTGCCTTTAGTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-1849s1c1
Sequence:CCGGGCCGGCACACTCTTTAAGAATCTCGAGATTCTTAAAGAGTGTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178440
MYO1G MISSION shRNA shRNA Plasmid DNA
myosin IG
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-954s1c1
Sequence:CCGGCGCCATATTACACCTGGGAAACTCGAGTTTCCCAGGTGTAATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-2920s1c1
Sequence:CCGGGCCCAAGGCTATGATGATCTTCTCGAGAAGATCATCATAGCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-953s1c1
Sequence:CCGGCCGCCATATTACACCTGGGAACTCGAGTTCCCAGGTGTAATATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-2683s1c1
Sequence:CCGGGCTGAGCAACTAAAGGCACTTCTCGAGAAGTGCCTTTAGTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-1849s1c1
Sequence:CCGGGCCGGCACACTCTTTAAGAATCTCGAGATTCTTAAAGAGTGTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178440
MYO1G MISSION shRNA Lentiviral Transduction Particles
myosin IG
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-954s1c1
Sequence:CCGGCGCCATATTACACCTGGGAAACTCGAGTTTCCCAGGTGTAATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-2920s1c1
Sequence:CCGGGCCCAAGGCTATGATGATCTTCTCGAGAAGATCATCATAGCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-953s1c1
Sequence:CCGGCCGCCATATTACACCTGGGAACTCGAGTTCCCAGGTGTAATATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-2683s1c1
Sequence:CCGGGCTGAGCAACTAAAGGCACTTCTCGAGAAGTGCCTTTAGTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178440.2-1849s1c1
Sequence:CCGGGCCGGCACACTCTTTAAGAATCTCGAGATTCTTAAAGAGTGTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks