EMAIL THIS PAGE TO A FRIEND

MYO5A

myosin VA (heavy chain 12, myoxin)

Synonyms: GS1 MYH12 MYO5 MYR12
Gene ID:
Human(4644) Summary: This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
Mouse(17918) myosin VA
Rat(25017) myosin VA
sheep(101105758) myosin VA (heavy chain 12, myoxin)
naked mole-rat(101697151) myosin VA (heavy chain 12, myoxin)
domestic guinea pig(100719609) myosin VA (heavy chain 12, myoxin)
chicken(396237) myosin VA (heavy chain 12, myosin)
cow(541234) myosin VA (heavy chain 12, myoxin)
Horse(100069548) myosin VA (heavy chain 12, myoxin)
domestic cat(101081303) myosin VA (heavy chain 12, myoxin)
dog(478312) myosin VA (heavy chain 12, myoxin)
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000259 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000259 Rosetta Predictions human pricing
NM_022178 Rosetta Predictions rat pricing
NM_010864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181251 predicted 4798
2 SASI_Hs01_00181252 predicted 3432
3 SASI_Hs01_00181256 predicted 4500
4 SASI_Hs02_00302198 predicted 2755
5 SASI_Hs01_00181257 predicted 952
6 SASI_Hs01_00181259 predicted 527
7 SASI_Hs01_00181260 predicted 2495
8 SASI_Hs02_00302199 predicted 2314
9 SASI_Hs02_00302200 predicted 4212
10 SASI_Hs02_00302201 predicted 640
11 SASI_Hs01_00181253 predicted 4122
12 SASI_Hs01_00181254 predicted 5557
13 SASI_Hs01_00181255 predicted 2181
14 SASI_Hs01_00181258 predicted 2769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042774 predicted 1308
2 SASI_Rn02_00262919 predicted 351
3 SASI_Rn02_00262920 predicted 1016
4 SASI_Rn02_00262921 predicted 3897
5 SASI_Rn02_00262922 predicted 2017
6 SASI_Rn01_00042776 predicted 1514
7 SASI_Rn02_00262923 predicted 648
8 SASI_Rn01_00042778 predicted 322
9 SASI_Rn01_00042779 predicted 4690
10 SASI_Rn01_00042780 predicted 742
11 SASI_Rn01_00042775 predicted 5289
12 SASI_Rn01_00042777 predicted 1391
13 SASI_Rn01_00042781 predicted 2302
14 SASI_Rn01_00042782 predicted 1516
15 SASI_Rn01_00042783 predicted 2897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066207 predicted 1507
2 SASI_Mm01_00066208 predicted 4030
3 SASI_Mm01_00066209 predicted 757
4 SASI_Mm01_00066210 predicted 4614
5 SASI_Mm02_00319531 predicted 2412
6 SASI_Mm01_00066211 predicted 3076
7 SASI_Mm01_00066212 predicted 1697
8 SASI_Mm01_00066214 predicted 711
9 SASI_Mm01_00066215 predicted 5462
10 SASI_Mm01_00066216 predicted 5819
11 SASI_Mm01_00066213 predicted 2294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010864
VALIDATED
MYO5A MISSION shRNA Bacterial Glycerol Stock
myosin VA (heavy chain 12, myoxin)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000100876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010864.1-2138s1c1
Sequence:CCGGCGGTGGACTTACCAAGAGTTTCTCGAGAAACTCTTGGTAAGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010864.1-5438s1c1
Sequence:CCGGCGCACTATACAGATGCGGTTACTCGAGTAACCGCATCTGTATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010864.1-2789s1c1
Sequence:CCGGCGCTACAAGAAGCTCCATATTCTCGAGAATATGGAGCTTCTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010864
VALIDATED
MYO5A MISSION shRNA shRNA Plasmid DNA
myosin VA (heavy chain 12, myoxin)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000100876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010864.1-2138s1c1
Sequence:CCGGCGGTGGACTTACCAAGAGTTTCTCGAGAAACTCTTGGTAAGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010864.1-5438s1c1
Sequence:CCGGCGCACTATACAGATGCGGTTACTCGAGTAACCGCATCTGTATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010864.1-2789s1c1
Sequence:CCGGCGCTACAAGAAGCTCCATATTCTCGAGAATATGGAGCTTCTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010864
VALIDATED
MYO5A MISSION shRNA Lentiviral Transduction Particles
myosin VA (heavy chain 12, myoxin)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000100876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010864.1-2138s1c1
Sequence:CCGGCGGTGGACTTACCAAGAGTTTCTCGAGAAACTCTTGGTAAGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010864.1-5438s1c1
Sequence:CCGGCGCACTATACAGATGCGGTTACTCGAGTAACCGCATCTGTATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010864.1-2789s1c1
Sequence:CCGGCGCTACAAGAAGCTCCATATTCTCGAGAATATGGAGCTTCTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000259
MYO5A MISSION shRNA Bacterial Glycerol Stock
myosin VA (heavy chain 12, myoxin)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-4921s1c1
Sequence:CCGGGCTCTCTAACACATGCCGATTCTCGAGAATCGGCATGTGTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-4637s1c1
Sequence:CCGGCCAGTCAACATTCCCAGGAAACTCGAGTTTCCTGGGAATGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-524s1c1
Sequence:CCGGCGCTTTATTGATTCCAAACTTCTCGAGAAGTTTGGAATCAATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-5654s1c1
Sequence:CCGGCGTACTATACAGATGCGTTTACTCGAGTAAACGCATCTGTATAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-1567s1c1
Sequence:CCGGCGGATTTGAAACATTTGAGATCTCGAGATCTCAAATGTTTCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-5636s21c1
Sequence:GTACCGGGTGTCGTTCATTCGTACTATACTCGAGTATAGTACGAATGAACGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4252s21c1
Sequence:GTACCGGGCTGGTTTATGAAGGGTTAAACTCGAGTTTAACCCTTCATAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-3440s21c1
Sequence:GTACCGGCAACTGGAACTCGACCTTAATCTCGAGATTAAGGTCGAGTTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4509s21c1
Sequence:GTACCGGAGGATAAGACGGTCCGTAAACCTCGAGGTTTACGGACCGTCTTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-2217s21c1
Sequence:GTACCGGTGCGCTGTATCAAGCCTAATGCTCGAGCATTAGGCTTGATACAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4735s21c1
Sequence:GTACCGGACGTGGTGTAGCAGTCAATTTCTCGAGAAATTGACTGCTACACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000259
MYO5A MISSION shRNA shRNA Plasmid DNA
myosin VA (heavy chain 12, myoxin)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-4921s1c1
Sequence:CCGGGCTCTCTAACACATGCCGATTCTCGAGAATCGGCATGTGTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-4637s1c1
Sequence:CCGGCCAGTCAACATTCCCAGGAAACTCGAGTTTCCTGGGAATGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-524s1c1
Sequence:CCGGCGCTTTATTGATTCCAAACTTCTCGAGAAGTTTGGAATCAATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-5654s1c1
Sequence:CCGGCGTACTATACAGATGCGTTTACTCGAGTAAACGCATCTGTATAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-1567s1c1
Sequence:CCGGCGGATTTGAAACATTTGAGATCTCGAGATCTCAAATGTTTCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-5636s21c1
Sequence:GTACCGGGTGTCGTTCATTCGTACTATACTCGAGTATAGTACGAATGAACGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4252s21c1
Sequence:GTACCGGGCTGGTTTATGAAGGGTTAAACTCGAGTTTAACCCTTCATAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-3440s21c1
Sequence:GTACCGGCAACTGGAACTCGACCTTAATCTCGAGATTAAGGTCGAGTTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4509s21c1
Sequence:GTACCGGAGGATAAGACGGTCCGTAAACCTCGAGGTTTACGGACCGTCTTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-2217s21c1
Sequence:GTACCGGTGCGCTGTATCAAGCCTAATGCTCGAGCATTAGGCTTGATACAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4735s21c1
Sequence:GTACCGGACGTGGTGTAGCAGTCAATTTCTCGAGAAATTGACTGCTACACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000259
MYO5A MISSION shRNA Lentiviral Transduction Particles
myosin VA (heavy chain 12, myoxin)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-4921s1c1
Sequence:CCGGGCTCTCTAACACATGCCGATTCTCGAGAATCGGCATGTGTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-4637s1c1
Sequence:CCGGCCAGTCAACATTCCCAGGAAACTCGAGTTTCCTGGGAATGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-524s1c1
Sequence:CCGGCGCTTTATTGATTCCAAACTTCTCGAGAAGTTTGGAATCAATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-5654s1c1
Sequence:CCGGCGTACTATACAGATGCGTTTACTCGAGTAAACGCATCTGTATAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000259.1-1567s1c1
Sequence:CCGGCGGATTTGAAACATTTGAGATCTCGAGATCTCAAATGTTTCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-5636s21c1
Sequence:GTACCGGGTGTCGTTCATTCGTACTATACTCGAGTATAGTACGAATGAACGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4252s21c1
Sequence:GTACCGGGCTGGTTTATGAAGGGTTAAACTCGAGTTTAACCCTTCATAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-3440s21c1
Sequence:GTACCGGCAACTGGAACTCGACCTTAATCTCGAGATTAAGGTCGAGTTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4509s21c1
Sequence:GTACCGGAGGATAAGACGGTCCGTAAACCTCGAGGTTTACGGACCGTCTTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-2217s21c1
Sequence:GTACCGGTGCGCTGTATCAAGCCTAATGCTCGAGCATTAGGCTTGATACAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000259.3-4735s21c1
Sequence:GTACCGGACGTGGTGTAGCAGTCAATTTCTCGAGAAATTGACTGCTACACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks