EMAIL THIS PAGE TO A FRIEND

MYO6

myosin VI

Synonyms: DFNA22 DFNB37
Gene ID:
Human(4646) Summary: This gene encodes a protein involved intracellular vesicle and organelle transport, especially in the hair cell of the inner ear. Mutations in this gene have been found in patients with non-syndromic autosomal dominant and recessive hearing loss. [provided by RefSeq, Jul 2008]
Mouse(17920) myosin VI
Rat(315840) myosin VI
sheep(101110599) myosin VI
chicken(395487) myosin VI
dog(481884) myosin VI
cow(535127) myosin VI
Horse(100065214) myosin VI
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004999 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079731 MISSION® esiRNA esiRNA human MYO6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004999 Rosetta Predictions human pricing
XM_001061392 Rosetta Predictions rat pricing
XM_236444 Rosetta Predictions rat pricing
NM_001039546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338739 predicted 1658
2 SASI_Hs02_00338740 predicted 359
3 SASI_Hs02_00338741 predicted 706
4 SASI_Hs01_00107391 predicted 2782
5 SASI_Hs01_00107393 predicted 2293
6 SASI_Hs01_00107394 predicted 2596
7 SASI_Hs01_00107395 predicted 887
8 SASI_Hs01_00107396 predicted 2519
9 SASI_Hs01_00107397 predicted 557
10 SASI_Hs01_00107398 predicted 1477
11 SASI_Hs01_00107390 predicted 3544
12 SASI_Hs01_00107392 predicted 790
13 SASI_Hs01_00107399 predicted 3524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299886 predicted 1405
2 SASI_Rn02_00299887 predicted 2005
3 SASI_Rn02_00299888 predicted 2387
4 SASI_Rn02_00299889 predicted 2553
5 SASI_Rn02_00299890 predicted 894
6 SASI_Rn02_00299891 predicted 2451
7 SASI_Rn02_00299892 predicted 296
8 SASI_Rn02_00299893 predicted 2742
9 SASI_Rn02_00299894 predicted 382
10 SASI_Rn02_00299895 predicted 2721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390049 predicted 1404
2 SASI_Rn02_00390050 predicted 2004
3 SASI_Rn02_00390051 predicted 2384
4 SASI_Rn02_00390052 predicted 2551
5 SASI_Rn02_00390053 predicted 895
6 SASI_Rn02_00390054 predicted 2448
7 SASI_Rn02_00390055 predicted 292
8 SASI_Rn02_00390056 predicted 2736
9 SASI_Rn02_00390057 predicted 380
10 SASI_Rn02_00390058 predicted 2726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059458 predicted 4089
2 SASI_Mm01_00059459 predicted 2047
3 SASI_Mm01_00059461 predicted 3389
4 SASI_Mm01_00059462 predicted 2560
5 SASI_Mm02_00290129 predicted 1482
6 SASI_Mm01_00059463 predicted 2907
7 SASI_Mm01_00059464 predicted 1749
8 SASI_Mm01_00059465 predicted 2538
9 SASI_Mm01_00059466 predicted 744
10 SASI_Mm01_00059467 predicted 475
11 SASI_Mm01_00059460 predicted 2021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039546
MYO6 MISSION shRNA Bacterial Glycerol Stock
myosin VI
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000348197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-2397s21c1
Sequence:CCGGAGATTGGATCCGAGGTTATTTCTCGAGAAATAACCTCGGATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-2760s21c1
Sequence:CCGGCGACTCGATAAGTTCAATGAACTCGAGTTCATTGAACTTATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-3881s21c1
Sequence:CCGGGCCCAGACAGTTTGAAGAGATCTCGAGATCTCTTCAAACTGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-1417s21c1
Sequence:CCGGGCACCAAAGGAACCGTTATAACTCGAGTTATAACGGTTCCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039546
MYO6 MISSION shRNA shRNA Plasmid DNA
myosin VI
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000348197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-2397s21c1
Sequence:CCGGAGATTGGATCCGAGGTTATTTCTCGAGAAATAACCTCGGATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-2760s21c1
Sequence:CCGGCGACTCGATAAGTTCAATGAACTCGAGTTCATTGAACTTATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-3881s21c1
Sequence:CCGGGCCCAGACAGTTTGAAGAGATCTCGAGATCTCTTCAAACTGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-1417s21c1
Sequence:CCGGGCACCAAAGGAACCGTTATAACTCGAGTTATAACGGTTCCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039546
MYO6 MISSION shRNA Lentiviral Transduction Particles
myosin VI
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000348197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-2397s21c1
Sequence:CCGGAGATTGGATCCGAGGTTATTTCTCGAGAAATAACCTCGGATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-2760s21c1
Sequence:CCGGCGACTCGATAAGTTCAATGAACTCGAGTTCATTGAACTTATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-3881s21c1
Sequence:CCGGGCCCAGACAGTTTGAAGAGATCTCGAGATCTCTTCAAACTGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039546.1-1417s21c1
Sequence:CCGGGCACCAAAGGAACCGTTATAACTCGAGTTATAACGGTTCCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004999
MYO6 MISSION shRNA Bacterial Glycerol Stock
myosin VI
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-3542s21c1
Sequence:CCGGCCATCAATACTTCTTGTGATACTCGAGTATCACAAGAAGTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.3-2108s1c1
Sequence:CCGGGTGAATCCAGAGATAAGTTTACTCGAGTAAACTTATCTCTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.3-1844s1c1
Sequence:CCGGTAGTGGGAATACTGGATATTTCTCGAGAAATATCCAGTATTCCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-2108s21c1
Sequence:CCGGGTGAATCCAGAGATAAGTTTACTCGAGTAAACTTATCTCTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-312s21c1
Sequence:CCGGCCCTACAGATGGATTTCAGATCTCGAGATCTGAAATCCATCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004999.3-4201s21c1
Sequence:CCGGCCAGATTTAACCATTCCATAACTCGAGTTATGGAATGGTTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-238s1c1
Sequence:CCGGCCCTACAGATGGATTTCAGATCTCGAGATCTGAAATCCATCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-3468s1c1
Sequence:CCGGCCATCAATACTTCTTGTGATACTCGAGTATCACAAGAAGTATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-4127s1c1
Sequence:CCGGCCAGATTTAACCATTCCATAACTCGAGTTATGGAATGGTTAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004999
MYO6 MISSION shRNA shRNA Plasmid DNA
myosin VI
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-3542s21c1
Sequence:CCGGCCATCAATACTTCTTGTGATACTCGAGTATCACAAGAAGTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.3-2108s1c1
Sequence:CCGGGTGAATCCAGAGATAAGTTTACTCGAGTAAACTTATCTCTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.3-1844s1c1
Sequence:CCGGTAGTGGGAATACTGGATATTTCTCGAGAAATATCCAGTATTCCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-2108s21c1
Sequence:CCGGGTGAATCCAGAGATAAGTTTACTCGAGTAAACTTATCTCTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-312s21c1
Sequence:CCGGCCCTACAGATGGATTTCAGATCTCGAGATCTGAAATCCATCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004999.3-4201s21c1
Sequence:CCGGCCAGATTTAACCATTCCATAACTCGAGTTATGGAATGGTTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-238s1c1
Sequence:CCGGCCCTACAGATGGATTTCAGATCTCGAGATCTGAAATCCATCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-3468s1c1
Sequence:CCGGCCATCAATACTTCTTGTGATACTCGAGTATCACAAGAAGTATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-4127s1c1
Sequence:CCGGCCAGATTTAACCATTCCATAACTCGAGTTATGGAATGGTTAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004999
MYO6 MISSION shRNA Lentiviral Transduction Particles
myosin VI
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-3542s21c1
Sequence:CCGGCCATCAATACTTCTTGTGATACTCGAGTATCACAAGAAGTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.3-2108s1c1
Sequence:CCGGGTGAATCCAGAGATAAGTTTACTCGAGTAAACTTATCTCTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.3-1844s1c1
Sequence:CCGGTAGTGGGAATACTGGATATTTCTCGAGAAATATCCAGTATTCCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-2108s21c1
Sequence:CCGGGTGAATCCAGAGATAAGTTTACTCGAGTAAACTTATCTCTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004999.3-312s21c1
Sequence:CCGGCCCTACAGATGGATTTCAGATCTCGAGATCTGAAATCCATCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004999.3-4201s21c1
Sequence:CCGGCCAGATTTAACCATTCCATAACTCGAGTTATGGAATGGTTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-238s1c1
Sequence:CCGGCCCTACAGATGGATTTCAGATCTCGAGATCTGAAATCCATCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-3468s1c1
Sequence:CCGGCCATCAATACTTCTTGTGATACTCGAGTATCACAAGAAGTATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004999.2-4127s1c1
Sequence:CCGGCCAGATTTAACCATTCCATAACTCGAGTTATGGAATGGTTAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008662
VALIDATED
MYO6 MISSION shRNA Bacterial Glycerol Stock
myosin VI
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008662.1-4432s1c1
Sequence:CCGGGCTTGCTTTCACACAAATCTACTCGAGTAGATTTGTGTGAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-2713s1c1
Sequence:CCGGCGACTCGATAAGTTCAATGAACTCGAGTTCATTGAACTTATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-3834s1c1
Sequence:CCGGGCCCAGACAGTTTGAAGAGATCTCGAGATCTCTTCAAACTGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-286s1c1
Sequence:CCGGGCTCTCATAAACCAAGTATTTCTCGAGAAATACTTGGTTTATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008662.1-960s1c1
Sequence:CCGGCCCAGATAATTTCCGGTATTTCTCGAGAAATACCGGAAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008662
VALIDATED
MYO6 MISSION shRNA shRNA Plasmid DNA
myosin VI
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008662.1-4432s1c1
Sequence:CCGGGCTTGCTTTCACACAAATCTACTCGAGTAGATTTGTGTGAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-2713s1c1
Sequence:CCGGCGACTCGATAAGTTCAATGAACTCGAGTTCATTGAACTTATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-3834s1c1
Sequence:CCGGGCCCAGACAGTTTGAAGAGATCTCGAGATCTCTTCAAACTGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-286s1c1
Sequence:CCGGGCTCTCATAAACCAAGTATTTCTCGAGAAATACTTGGTTTATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008662.1-960s1c1
Sequence:CCGGCCCAGATAATTTCCGGTATTTCTCGAGAAATACCGGAAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008662
VALIDATED
MYO6 MISSION shRNA Lentiviral Transduction Particles
myosin VI
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008662.1-4432s1c1
Sequence:CCGGGCTTGCTTTCACACAAATCTACTCGAGTAGATTTGTGTGAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-2713s1c1
Sequence:CCGGCGACTCGATAAGTTCAATGAACTCGAGTTCATTGAACTTATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-3834s1c1
Sequence:CCGGGCCCAGACAGTTTGAAGAGATCTCGAGATCTCTTCAAACTGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008662.1-286s1c1
Sequence:CCGGGCTCTCATAAACCAAGTATTTCTCGAGAAATACTTGGTTTATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008662.1-960s1c1
Sequence:CCGGCCCAGATAATTTCCGGTATTTCTCGAGAAATACCGGAAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks