EMAIL THIS PAGE TO A FRIEND

MYOM3

myomesin 3

Synonyms: RP11-293P20.1
Gene ID:
Mouse(242702) myomesin family, member 3
Rat(313625) myomesin 3
sheep(101118423) myomesin 3
Zebrafish(559614) myomesin family, member 3
chicken(419690) myomesin family, member 3
dog(487372) myomesin 3
cow(532872) myomesin 3
Horse(100071517) myomesin 3
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152372 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152372 Rosetta Predictions human pricing
NM_001107987 Rosetta Predictions rat pricing
NM_001085509 Rosetta Predictions mouse pricing
XM_144099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230608 predicted 3007
2 SASI_Hs01_00230609 predicted 3687
3 SASI_Hs02_00366018 predicted 1281
4 SASI_Hs01_00230612 predicted 2662
5 SASI_Hs02_00366019 predicted 911
6 SASI_Hs02_00366020 predicted 802
7 SASI_Hs02_00366021 predicted 837
8 SASI_Hs01_00230615 predicted 2098
9 SASI_Hs01_00230617 predicted 2772
10 SASI_Hs02_00366022 predicted 2128
11 SASI_Hs01_00230610 predicted 3315
12 SASI_Hs01_00230611 predicted 1144
13 SASI_Hs01_00230613 predicted 1663
14 SASI_Hs01_00230614 predicted 1194
15 SASI_Hs01_00230616 predicted 2007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234245 predicted 3262
2 SASI_Rn02_00234246 predicted 1497
3 SASI_Rn02_00234247 predicted 855
4 SASI_Rn02_00234248 predicted 3084
5 SASI_Rn02_00234249 predicted 2724
6 SASI_Rn02_00234250 predicted 1773
7 SASI_Rn02_00234251 predicted 3333
8 SASI_Rn02_00234252 predicted 1245
9 SASI_Rn02_00234253 predicted 1438
10 SASI_Rn02_00234254 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300672 predicted 1646
2 SASI_Mm02_00300673 predicted 978
3 SASI_Mm02_00300674 predicted 417
4 SASI_Mm02_00300675 predicted 834
5 SASI_Mm02_00300676 predicted 3304
6 SASI_Mm02_00300677 predicted 3468
7 SASI_Mm02_00300678 predicted 1839
8 SASI_Mm02_00300679 predicted 3668
9 SASI_Mm02_00300680 predicted 2328
10 SASI_Mm02_00300681 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275081 predicted 973
2 SASI_Mm01_00275082 predicted 419
3 SASI_Mm01_00275083 predicted 835
4 SASI_Mm01_00275084 predicted 3303
5 SASI_Mm01_00275085 predicted 3470
6 SASI_Mm01_00275086 predicted 1842
7 SASI_Mm01_00275087 predicted 3671
8 SASI_Mm01_00275088 predicted 2329
9 SASI_Mm01_00275089 predicted 1410
10 SASI_Mm01_00275090 predicted 3549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152372
MYOM3 MISSION shRNA Bacterial Glycerol Stock
myomesin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3312s1c1
Sequence:CCGGCCCTGAAATCTCTTGGCTGAACTCGAGTTCAGCCAAGAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-1356s1c1
Sequence:CCGGCGGGAAGAATGAAATGGTCATCTCGAGATGACCATTTCATTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-4342s1c1
Sequence:CCGGCGGTCTCTACTAGGAATACAACTCGAGTTGTATTCCTAGTAGAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-2772s1c1
Sequence:CCGGCAAGGGAATTTACAGAGCGATCTCGAGATCGCTCTGTAAATTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3210s1c1
Sequence:CCGGCGAGAAGAATCGTGCCAAAGTCTCGAGACTTTGGCACGATTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3908s1c1
Sequence:CCGGCCCTGCCATAAACTGATACATCTCGAGATGTATCAGTTTATGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-3945s21c1
Sequence:CCGGTGGAGAGTGGTGATCGGATAACTCGAGTTATCCGATCACCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-4016s21c1
Sequence:CCGGGACTCAGACAAGGGCAAATACCTCGAGGTATTTGCCCTTGTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-3442s21c1
Sequence:CCGGGACACTGGTGGATGACGATTTCTCGAGAAATCGTCATCCACCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152372
MYOM3 MISSION shRNA shRNA Plasmid DNA
myomesin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3312s1c1
Sequence:CCGGCCCTGAAATCTCTTGGCTGAACTCGAGTTCAGCCAAGAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-1356s1c1
Sequence:CCGGCGGGAAGAATGAAATGGTCATCTCGAGATGACCATTTCATTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-4342s1c1
Sequence:CCGGCGGTCTCTACTAGGAATACAACTCGAGTTGTATTCCTAGTAGAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-2772s1c1
Sequence:CCGGCAAGGGAATTTACAGAGCGATCTCGAGATCGCTCTGTAAATTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3210s1c1
Sequence:CCGGCGAGAAGAATCGTGCCAAAGTCTCGAGACTTTGGCACGATTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3908s1c1
Sequence:CCGGCCCTGCCATAAACTGATACATCTCGAGATGTATCAGTTTATGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-3945s21c1
Sequence:CCGGTGGAGAGTGGTGATCGGATAACTCGAGTTATCCGATCACCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-4016s21c1
Sequence:CCGGGACTCAGACAAGGGCAAATACCTCGAGGTATTTGCCCTTGTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-3442s21c1
Sequence:CCGGGACACTGGTGGATGACGATTTCTCGAGAAATCGTCATCCACCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152372
MYOM3 MISSION shRNA Lentiviral Transduction Particles
myomesin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3312s1c1
Sequence:CCGGCCCTGAAATCTCTTGGCTGAACTCGAGTTCAGCCAAGAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-1356s1c1
Sequence:CCGGCGGGAAGAATGAAATGGTCATCTCGAGATGACCATTTCATTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-4342s1c1
Sequence:CCGGCGGTCTCTACTAGGAATACAACTCGAGTTGTATTCCTAGTAGAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-2772s1c1
Sequence:CCGGCAAGGGAATTTACAGAGCGATCTCGAGATCGCTCTGTAAATTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3210s1c1
Sequence:CCGGCGAGAAGAATCGTGCCAAAGTCTCGAGACTTTGGCACGATTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152372.2-3908s1c1
Sequence:CCGGCCCTGCCATAAACTGATACATCTCGAGATGTATCAGTTTATGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-3945s21c1
Sequence:CCGGTGGAGAGTGGTGATCGGATAACTCGAGTTATCCGATCACCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-4016s21c1
Sequence:CCGGGACTCAGACAAGGGCAAATACCTCGAGGTATTTGCCCTTGTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152372.3-3442s21c1
Sequence:CCGGGACACTGGTGGATGACGATTTCTCGAGAAATCGTCATCCACCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085509
MYOM3 MISSION shRNA Bacterial Glycerol Stock
myomesin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-3265s21c1
Sequence:CCGGCGAACCGCAAGATCAACTTTGCTCGAGCAAAGTTGATCTTGCGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-1517s21c1
Sequence:CCGGTGACTATGATGCAGTCCATAACTCGAGTTATGGACTGCATCATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-1998s21c1
Sequence:CCGGTCGGAGCTCCTGGGTTATTACCTCGAGGTAATAACCCAGGAGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085509.1-4859s21c1
Sequence:CCGGCTGGCATTGAGTGGGTTAATACTCGAGTATTAACCCACTCAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-839s21c1
Sequence:CCGGCAAAGTCCTCATCCGCAATTACTCGAGTAATTGCGGATGAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085509
MYOM3 MISSION shRNA shRNA Plasmid DNA
myomesin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-3265s21c1
Sequence:CCGGCGAACCGCAAGATCAACTTTGCTCGAGCAAAGTTGATCTTGCGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-1517s21c1
Sequence:CCGGTGACTATGATGCAGTCCATAACTCGAGTTATGGACTGCATCATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-1998s21c1
Sequence:CCGGTCGGAGCTCCTGGGTTATTACCTCGAGGTAATAACCCAGGAGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085509.1-4859s21c1
Sequence:CCGGCTGGCATTGAGTGGGTTAATACTCGAGTATTAACCCACTCAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-839s21c1
Sequence:CCGGCAAAGTCCTCATCCGCAATTACTCGAGTAATTGCGGATGAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085509
MYOM3 MISSION shRNA Lentiviral Transduction Particles
myomesin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-3265s21c1
Sequence:CCGGCGAACCGCAAGATCAACTTTGCTCGAGCAAAGTTGATCTTGCGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-1517s21c1
Sequence:CCGGTGACTATGATGCAGTCCATAACTCGAGTTATGGACTGCATCATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-1998s21c1
Sequence:CCGGTCGGAGCTCCTGGGTTATTACCTCGAGGTAATAACCCAGGAGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085509.1-4859s21c1
Sequence:CCGGCTGGCATTGAGTGGGTTAATACTCGAGTATTAACCCACTCAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085509.1-839s21c1
Sequence:CCGGCAAAGTCCTCATCCGCAATTACTCGAGTAATTGCGGATGAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks