EMAIL THIS PAGE TO A FRIEND

MYPOP

Myb-related transcription factor, partner of profilin

Synonyms: P42pop
UniProtKB ID: Q86VE0
Gene ID:
Mouse(232934) Myb-related transcription factor, partner of profilin
Rat(499090) Myb-related transcription factor, partner of profilin
cow(520267) Myb-related transcription factor, partner of profilin
dog(612218) Myb-related transcription factor, partner of profilin
domestic cat(101080927) Myb-related transcription factor, partner of profilin
naked mole-rat(101701359) Myb-related transcription factor, partner of profilin
domestic guinea pig(100714642) Myb-related transcription factor, partner of profilin
sheep(101119928) Myb-related transcription factor, partner of profilin
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012643 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012643 Rosetta Predictions human pricing
NM_001109139 Rosetta Predictions rat pricing
NM_145579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152379 predicted 263
2 SASI_Hs01_00152380 predicted 257
3 SASI_Hs01_00152381 predicted 263
4 SASI_Hs01_00152382 predicted 253
5 SASI_Hs01_00152383 predicted 315
6 SASI_Hs01_00152384 predicted 325
7 SASI_Hs01_00152385 predicted 409
8 SASI_Hs01_00152386 predicted 355
9 SASI_Hs01_00152387 predicted 386
10 SASI_Hs01_00152388 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245510 predicted 222
2 SASI_Rn02_00245511 predicted 269
3 SASI_Rn02_00245512 predicted 1475
4 SASI_Rn02_00245513 predicted 1321
5 SASI_Rn02_00245514 predicted 655
6 SASI_Rn02_00245515 predicted 336
7 SASI_Rn02_00245516 predicted 1584
8 SASI_Rn02_00245517 predicted 351
9 SASI_Rn02_00245518 predicted 226
10 SASI_Rn02_00245519 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044269 predicted 1870
2 SASI_Mm02_00341109 predicted 1552
3 SASI_Mm01_00044275 predicted 877
4 SASI_Mm01_00044276 predicted 428
5 SASI_Mm01_00044277 predicted 497
6 SASI_Mm02_00341110 predicted 1879
7 SASI_Mm02_00341111 predicted 1707
8 SASI_Mm02_00341112 predicted 1803
9 SASI_Mm01_00044278 predicted 640
10 SASI_Mm02_00341113 predicted 836
11 SASI_Mm01_00044270 predicted 1304
12 SASI_Mm01_00044271 predicted 946
13 SASI_Mm01_00044272 predicted 1595
14 SASI_Mm01_00044273 predicted 1491
15 SASI_Mm01_00044274 predicted 957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145579
MYPOP MISSION shRNA Bacterial Glycerol Stock
Myb-related transcription factor, partner of profilin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1599s1c1
Sequence:CCGGCTTTGCCTAATAGTTACTGTTCTCGAGAACAGTAACTATTAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1493s1c1
Sequence:CCGGGCTAGTTACTGCCTCCTGTAACTCGAGTTACAGGAGGCAGTAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145579.1-1301s1c1
Sequence:CCGGGAAAGGTTTCCCTACACGAAACTCGAGTTTCGTGTAGGGAAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1691s1c1
Sequence:CCGGCAGTTGCTAGACAAATCAGAACTCGAGTTCTGATTTGTCTAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-1553s21c1
Sequence:CCGGCGCTGGAAGTCTCCGTGAAATCTCGAGATTTCACGGAGACTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-729s21c1
Sequence:CCGGCTGCGGAGGAGGAGACTATTTCTCGAGAAATAGTCTCCTCCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145579.3-1982s21c1
Sequence:CCGGCAGTTGCTAGACAAATCAGAACTCGAGTTCTGATTTGTCTAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-1522s21c1
Sequence:CCGGGAAAGGTTTCCCTACACGAAACTCGAGTTTCGTGTAGGGAAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145579
MYPOP MISSION shRNA shRNA Plasmid DNA
Myb-related transcription factor, partner of profilin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1599s1c1
Sequence:CCGGCTTTGCCTAATAGTTACTGTTCTCGAGAACAGTAACTATTAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1493s1c1
Sequence:CCGGGCTAGTTACTGCCTCCTGTAACTCGAGTTACAGGAGGCAGTAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145579.1-1301s1c1
Sequence:CCGGGAAAGGTTTCCCTACACGAAACTCGAGTTTCGTGTAGGGAAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1691s1c1
Sequence:CCGGCAGTTGCTAGACAAATCAGAACTCGAGTTCTGATTTGTCTAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-1553s21c1
Sequence:CCGGCGCTGGAAGTCTCCGTGAAATCTCGAGATTTCACGGAGACTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-729s21c1
Sequence:CCGGCTGCGGAGGAGGAGACTATTTCTCGAGAAATAGTCTCCTCCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145579.3-1982s21c1
Sequence:CCGGCAGTTGCTAGACAAATCAGAACTCGAGTTCTGATTTGTCTAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-1522s21c1
Sequence:CCGGGAAAGGTTTCCCTACACGAAACTCGAGTTTCGTGTAGGGAAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145579
MYPOP MISSION shRNA Lentiviral Transduction Particles
Myb-related transcription factor, partner of profilin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1599s1c1
Sequence:CCGGCTTTGCCTAATAGTTACTGTTCTCGAGAACAGTAACTATTAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1493s1c1
Sequence:CCGGGCTAGTTACTGCCTCCTGTAACTCGAGTTACAGGAGGCAGTAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145579.1-1301s1c1
Sequence:CCGGGAAAGGTTTCCCTACACGAAACTCGAGTTTCGTGTAGGGAAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145579.1-1691s1c1
Sequence:CCGGCAGTTGCTAGACAAATCAGAACTCGAGTTCTGATTTGTCTAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-1553s21c1
Sequence:CCGGCGCTGGAAGTCTCCGTGAAATCTCGAGATTTCACGGAGACTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-729s21c1
Sequence:CCGGCTGCGGAGGAGGAGACTATTTCTCGAGAAATAGTCTCCTCCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145579.3-1982s21c1
Sequence:CCGGCAGTTGCTAGACAAATCAGAACTCGAGTTCTGATTTGTCTAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145579.3-1522s21c1
Sequence:CCGGGAAAGGTTTCCCTACACGAAACTCGAGTTTCGTGTAGGGAAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012643
MYPOP MISSION shRNA Bacterial Glycerol Stock
Myb-related transcription factor, partner of profilin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.1-153s1c1
Sequence:CCGGCGAAGAGAACCAGATCCTGATCTCGAGATCAGGATCTGGTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.2-141s1c1
Sequence:CCGGGCGCTTCTCATTCGAAGAGAACTCGAGTTCTCTTCGAATGAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012643.2-1515s1c1
Sequence:CCGGCCCTGACTTCTAAGCCATCAACTCGAGTTGATGGCTTAGAAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012643.2-1601s1c1
Sequence:CCGGCCTTCCCTAACAGTTCCTGTTCTCGAGAACAGGAACTGTTAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.2-269s1c1
Sequence:CCGGCCAAGATCAACGGTATCACCACTCGAGTGGTGATACCGTTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012643.2-1685s21c1
Sequence:CCGGGGTGGGAGTTGTAAGACAAATCTCGAGATTTGTCTTACAACTCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012643.2-318s21c1
Sequence:CCGGGAAGCGCTGGAACGACTTCAACTCGAGTTGAAGTCGTTCCAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012643
MYPOP MISSION shRNA shRNA Plasmid DNA
Myb-related transcription factor, partner of profilin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.1-153s1c1
Sequence:CCGGCGAAGAGAACCAGATCCTGATCTCGAGATCAGGATCTGGTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.2-141s1c1
Sequence:CCGGGCGCTTCTCATTCGAAGAGAACTCGAGTTCTCTTCGAATGAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012643.2-1515s1c1
Sequence:CCGGCCCTGACTTCTAAGCCATCAACTCGAGTTGATGGCTTAGAAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012643.2-1601s1c1
Sequence:CCGGCCTTCCCTAACAGTTCCTGTTCTCGAGAACAGGAACTGTTAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.2-269s1c1
Sequence:CCGGCCAAGATCAACGGTATCACCACTCGAGTGGTGATACCGTTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012643.2-1685s21c1
Sequence:CCGGGGTGGGAGTTGTAAGACAAATCTCGAGATTTGTCTTACAACTCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012643.2-318s21c1
Sequence:CCGGGAAGCGCTGGAACGACTTCAACTCGAGTTGAAGTCGTTCCAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012643
MYPOP MISSION shRNA Lentiviral Transduction Particles
Myb-related transcription factor, partner of profilin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.1-153s1c1
Sequence:CCGGCGAAGAGAACCAGATCCTGATCTCGAGATCAGGATCTGGTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.2-141s1c1
Sequence:CCGGGCGCTTCTCATTCGAAGAGAACTCGAGTTCTCTTCGAATGAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012643.2-1515s1c1
Sequence:CCGGCCCTGACTTCTAAGCCATCAACTCGAGTTGATGGCTTAGAAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012643.2-1601s1c1
Sequence:CCGGCCTTCCCTAACAGTTCCTGTTCTCGAGAACAGGAACTGTTAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012643.2-269s1c1
Sequence:CCGGCCAAGATCAACGGTATCACCACTCGAGTGGTGATACCGTTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012643.2-1685s21c1
Sequence:CCGGGGTGGGAGTTGTAAGACAAATCTCGAGATTTGTCTTACAACTCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012643.2-318s21c1
Sequence:CCGGGAAGCGCTGGAACGACTTCAACTCGAGTTGAAGTCGTTCCAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks