EMAIL THIS PAGE TO A FRIEND

MYRF

myelin regulatory factor

Synonyms: C11orf9 MRF Ndt80 pqn-47
UniProtKB ID: Q9Y2G1, O43582, Q9P1Q6
Gene ID:
Mouse(225908) myelin regulatory factor
Rat(293736) myelin regulatory factor
Zebrafish(570792) myelin regulatory factor
cow(509704) myelin regulatory factor
domestic guinea pig(100724735) myelin regulatory factor
naked mole-rat(101699599) myelin regulatory factor
225 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100241 Anti-C11ORF9 antibody produced in rabbit affinity isolated antibody zebrafish, mouse, rat, human, horse, guinea pig, rabbit
western blot pricing
HPA018310 Anti-MYRF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127392 Rosetta Predictions human pricing
NM_013279 Rosetta Predictions human pricing
XM_001074493 Rosetta Predictions rat pricing
XM_215195 Rosetta Predictions rat pricing
XM_359374 Rosetta Predictions mouse pricing
XM_888586 Rosetta Predictions mouse pricing
XM_898141 Rosetta Predictions mouse pricing
XM_981099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329394 predicted 3506
2 SASI_Hs02_00329395 predicted 1464
3 SASI_Hs02_00329396 predicted 1661
4 SASI_Hs02_00329397 predicted 3886
5 SASI_Hs02_00329398 predicted 2029
6 SASI_Hs02_00329399 predicted 1548
7 SASI_Hs02_00329400 predicted 3885
8 SASI_Hs02_00329401 predicted 3611
9 SASI_Hs02_00329402 predicted 1542
10 SASI_Hs02_00329403 predicted 3813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083600 predicted 3332
2 SASI_Hs01_00083601 predicted 1372
3 SASI_Hs01_00083603 predicted 1571
4 SASI_Hs02_00344532 predicted 3706
5 SASI_Hs01_00083604 predicted 1946
6 SASI_Hs01_00083606 predicted 1464
7 SASI_Hs02_00344533 predicted 3702
8 SASI_Hs01_00083607 predicted 3428
9 SASI_Hs01_00083608 predicted 1461
10 SASI_Hs02_00344534 predicted 3629
11 SASI_Hs01_00083602 predicted 1315
12 SASI_Hs01_00083605 predicted 2357
13 SASI_Hs01_00083609 predicted 3146
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346436 predicted 3228
2 SASI_Rn02_00346437 predicted 1801
3 SASI_Rn02_00346438 predicted 1282
4 SASI_Rn02_00346439 predicted 2048
5 SASI_Rn02_00346440 predicted 1275
6 SASI_Rn02_00346441 predicted 568
7 SASI_Rn02_00346442 predicted 2525
8 SASI_Rn02_00346443 predicted 3814
9 SASI_Rn02_00346444 predicted 1607
10 SASI_Rn02_00346445 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375845 predicted 2821
2 SASI_Rn02_00375846 predicted 1400
3 SASI_Rn02_00375847 predicted 372
4 SASI_Rn02_00375848 predicted 889
5 SASI_Rn02_00375849 predicted 881
6 SASI_Rn02_00375850 predicted 3410
7 SASI_Rn02_00375851 predicted 1224
8 SASI_Rn02_00375852 predicted 1380
9 SASI_Rn02_00375853 predicted 2828
10 SASI_Rn02_00375854 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_359374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426330 predicted 267
2 SASI_Mm02_00426331 predicted 784
3 SASI_Mm02_00426332 predicted 785
4 SASI_Mm02_00426333 predicted 352
5 SASI_Mm02_00426334 predicted 435
6 SASI_Mm02_00426335 predicted 660
7 SASI_Mm02_00426336 predicted 806
8 SASI_Mm02_00426337 predicted 352
9 SASI_Mm02_00426338 predicted 585
10 SASI_Mm02_00426339 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428660 predicted 1537
2 SASI_Mm02_00428661 predicted 3614
3 SASI_Mm02_00428662 predicted 1621
4 SASI_Mm01_00240271 predicted 1054
5 SASI_Mm02_00428663 predicted 3573
6 SASI_Mm01_00240273 predicted 1674
7 SASI_Mm01_00240275 predicted 1106
8 SASI_Mm01_00240277 predicted 1088
9 SASI_Mm02_00428664 predicted 1425
10 SASI_Mm02_00428665 predicted 1927
11 SASI_Mm01_00240268 predicted 2485
12 SASI_Mm01_00240269 predicted 2626
13 SASI_Mm01_00240270 predicted 950
14 SASI_Mm01_00240272 predicted 3122
15 SASI_Mm01_00240274 predicted 2125
16 SASI_Mm01_00240276 predicted 2888
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215669 predicted 743
2 SASI_Mm01_00215670 predicted 910
3 SASI_Mm01_00215671 predicted 719
4 SASI_Mm01_00215672 predicted 236
5 SASI_Mm01_00215673 predicted 675
6 SASI_Mm01_00215674 predicted 748
7 SASI_Mm01_00215675 predicted 738
8 SASI_Mm01_00215676 predicted 964
9 SASI_Mm01_00215677 predicted 888
10 SASI_Mm01_00215678 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447492 predicted 2316
2 SASI_Mm02_00447493 predicted 2448
3 SASI_Mm02_00447494 predicted 2009
4 SASI_Mm02_00447495 predicted 768
5 SASI_Mm02_00447496 predicted 1618
6 SASI_Mm02_00447497 predicted 2954
7 SASI_Mm02_00447498 predicted 1675
8 SASI_Mm02_00447499 predicted 1110
9 SASI_Mm02_00447500 predicted 2158
10 SASI_Mm02_00447501 predicted 2713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033481
VALIDATED
MYRF MISSION shRNA Bacterial Glycerol Stock
myelin regulatory factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-1466s21c1
Sequence:CCGGTGAACCAGTCTATCAACATTGCTCGAGCAATGTTGATAGACTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-2868s21c1
Sequence:CCGGAGCTAATGGCATCAGCTATTCCTCGAGGAATAGCTGATGCCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-3737s21c1
Sequence:CCGGACTTCATGGCTGTCTAGTTATCTCGAGATAACTAGACAGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-1156s21c1
Sequence:CCGGAGCCTCAGTGGCTCCTATTTGCTCGAGCAAATAGGAGCCACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-2486s21c1
Sequence:CCGGTGTCTATGTCCACACTATATGCTCGAGCATATAGTGTGGACATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033481
VALIDATED
MYRF MISSION shRNA shRNA Plasmid DNA
myelin regulatory factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-1466s21c1
Sequence:CCGGTGAACCAGTCTATCAACATTGCTCGAGCAATGTTGATAGACTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-2868s21c1
Sequence:CCGGAGCTAATGGCATCAGCTATTCCTCGAGGAATAGCTGATGCCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-3737s21c1
Sequence:CCGGACTTCATGGCTGTCTAGTTATCTCGAGATAACTAGACAGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-1156s21c1
Sequence:CCGGAGCCTCAGTGGCTCCTATTTGCTCGAGCAAATAGGAGCCACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-2486s21c1
Sequence:CCGGTGTCTATGTCCACACTATATGCTCGAGCATATAGTGTGGACATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033481
VALIDATED
MYRF MISSION shRNA Lentiviral Transduction Particles
myelin regulatory factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-1466s21c1
Sequence:CCGGTGAACCAGTCTATCAACATTGCTCGAGCAATGTTGATAGACTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-2868s21c1
Sequence:CCGGAGCTAATGGCATCAGCTATTCCTCGAGGAATAGCTGATGCCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-3737s21c1
Sequence:CCGGACTTCATGGCTGTCTAGTTATCTCGAGATAACTAGACAGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-1156s21c1
Sequence:CCGGAGCCTCAGTGGCTCCTATTTGCTCGAGCAAATAGGAGCCACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033481.1-2486s21c1
Sequence:CCGGTGTCTATGTCCACACTATATGCTCGAGCATATAGTGTGGACATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013279
VALIDATED
MYRF MISSION shRNA Bacterial Glycerol Stock
myelin regulatory factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-4611s21c1
Sequence:CCGGTCATGGAAGGAGTGTAGTATTCTCGAGAATACTACACTCCTTCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1739s21c1
Sequence:CCGGCAAGGTCATGGGCTCGCTTATCTCGAGATAAGCGAGCCCATGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-817s21c1
Sequence:CCGGTGCTGAATGGAATGATCAAACCTCGAGGTTTGATCATTCCATTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1960s21c1
Sequence:CCGGACACCGGAGACATGGTCTTTGCTCGAGCAAAGACCATGTCTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1325s21c1
Sequence:CCGGGGCCCTGAACCAGTCCATTAACTCGAGTTAATGGACTGGTTCAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013279.1-1283s1c1
Sequence:CCGGCCTCGACTGCTTCTATCTGAACTCGAGTTCAGATAGAAGCAGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013279.1-1841s1c1
Sequence:CCGGGCTGGTGCACTACAGATACAACTCGAGTTGTATCTGTAGTGCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013279
VALIDATED
MYRF MISSION shRNA shRNA Plasmid DNA
myelin regulatory factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-4611s21c1
Sequence:CCGGTCATGGAAGGAGTGTAGTATTCTCGAGAATACTACACTCCTTCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1739s21c1
Sequence:CCGGCAAGGTCATGGGCTCGCTTATCTCGAGATAAGCGAGCCCATGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-817s21c1
Sequence:CCGGTGCTGAATGGAATGATCAAACCTCGAGGTTTGATCATTCCATTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1960s21c1
Sequence:CCGGACACCGGAGACATGGTCTTTGCTCGAGCAAAGACCATGTCTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1325s21c1
Sequence:CCGGGGCCCTGAACCAGTCCATTAACTCGAGTTAATGGACTGGTTCAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013279.1-1283s1c1
Sequence:CCGGCCTCGACTGCTTCTATCTGAACTCGAGTTCAGATAGAAGCAGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013279.1-1841s1c1
Sequence:CCGGGCTGGTGCACTACAGATACAACTCGAGTTGTATCTGTAGTGCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013279
VALIDATED
MYRF MISSION shRNA Lentiviral Transduction Particles
myelin regulatory factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-4611s21c1
Sequence:CCGGTCATGGAAGGAGTGTAGTATTCTCGAGAATACTACACTCCTTCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1739s21c1
Sequence:CCGGCAAGGTCATGGGCTCGCTTATCTCGAGATAAGCGAGCCCATGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-817s21c1
Sequence:CCGGTGCTGAATGGAATGATCAAACCTCGAGGTTTGATCATTCCATTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1960s21c1
Sequence:CCGGACACCGGAGACATGGTCTTTGCTCGAGCAAAGACCATGTCTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013279.1-1325s21c1
Sequence:CCGGGGCCCTGAACCAGTCCATTAACTCGAGTTAATGGACTGGTTCAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013279.1-1283s1c1
Sequence:CCGGCCTCGACTGCTTCTATCTGAACTCGAGTTCAGATAGAAGCAGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013279.1-1841s1c1
Sequence:CCGGGCTGGTGCACTACAGATACAACTCGAGTTGTATCTGTAGTGCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks