EMAIL THIS PAGE TO A FRIEND

MYRFL

myelin regulatory factor-like

Synonyms: C12orf15 C12orf28 bcm1377
UniProtKB ID: Q96LU7
Gene ID:
Mouse(237558) myelin regulatory factor-like
Rat(362879) myelin regulatory factor-like
naked mole-rat(101725887) myelin regulatory factor-like
domestic guinea pig(100721085) myelin regulatory factor-like
chicken(100858458) myelin regulatory factor-like
cow(781109) myelin regulatory factor-like
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049340 Anti-MYRFL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182530 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182530 Rosetta Predictions human pricing
XM_001716650 Rosetta Predictions human pricing
XM_001718058 Rosetta Predictions human pricing
XM_001718908 Rosetta Predictions human pricing
XM_001080934 Rosetta Predictions rat pricing
XM_343208 Rosetta Predictions rat pricing
NM_001033333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242244 predicted 616
2 SASI_Hs01_00242245 predicted 991
3 SASI_Hs01_00242246 predicted 361
4 SASI_Hs01_00242247 predicted 637
5 SASI_Hs01_00242248 predicted 395
6 SASI_Hs01_00242249 predicted 758
7 SASI_Hs01_00242250 predicted 956
8 SASI_Hs01_00242251 predicted 400
9 SASI_Hs01_00242252 predicted 601
10 SASI_Hs01_00242253 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411947 predicted 1405
2 SASI_Hs02_00411948 predicted 1181
3 SASI_Hs02_00411949 predicted 2298
4 SASI_Hs02_00411950 predicted 1594
5 SASI_Hs02_00411951 predicted 1012
6 SASI_Hs02_00411952 predicted 705
7 SASI_Hs02_00411953 predicted 720
8 SASI_Hs02_00411954 predicted 2038
9 SASI_Hs02_00411955 predicted 907
10 SASI_Hs02_00411956 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00421386 predicted 459
2 SASI_Hs02_00421387 predicted 1452
3 SASI_Hs02_00421388 predicted 1220
4 SASI_Hs02_00421389 predicted 2349
5 SASI_Hs02_00421390 predicted 1632
6 SASI_Hs02_00421391 predicted 1059
7 SASI_Hs02_00421392 predicted 753
8 SASI_Hs02_00421393 predicted 532
9 SASI_Hs02_00421394 predicted 2082
10 SASI_Hs02_00421395 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00427069 predicted 594
2 SASI_Hs02_00427070 predicted 1599
3 SASI_Hs02_00427071 predicted 1363
4 SASI_Hs02_00427072 predicted 2490
5 SASI_Hs02_00427073 predicted 1780
6 SASI_Hs02_00427074 predicted 1205
7 SASI_Hs02_00427075 predicted 889
8 SASI_Hs02_00427076 predicted 676
9 SASI_Hs02_00427077 predicted 2232
10 SASI_Hs02_00427078 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369910 predicted 921
2 SASI_Rn02_00369911 predicted 2509
3 SASI_Rn02_00369912 predicted 2745
4 SASI_Rn02_00369913 predicted 2577
5 SASI_Rn02_00369914 predicted 1951
6 SASI_Rn02_00369915 predicted 1313
7 SASI_Rn02_00369916 predicted 1107
8 SASI_Rn02_00369917 predicted 1212
9 SASI_Rn02_00369918 predicted 1585
10 SASI_Rn02_00369919 predicted 2546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150532 predicted 4425
2 SASI_Rn01_00150533 predicted 3175
3 SASI_Rn01_00150534 predicted 3623
4 SASI_Rn01_00150535 predicted 3404
5 SASI_Rn01_00150536 predicted 1620
6 SASI_Rn01_00150537 predicted 942
7 SASI_Rn01_00150538 predicted 506
8 SASI_Rn01_00150539 predicted 3645
9 SASI_Rn01_00150540 predicted 3229
10 SASI_Rn01_00150541 predicted 3730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143257 predicted 1376
2 SASI_Mm01_00143258 predicted 2850
3 SASI_Mm01_00143259 predicted 1450
4 SASI_Mm02_00288583 predicted 1983
5 SASI_Mm01_00143260 predicted 1222
6 SASI_Mm01_00143262 predicted 1313
7 SASI_Mm01_00143263 predicted 1115
8 SASI_Mm01_00143264 predicted 2442
9 SASI_Mm02_00288584 predicted 879
10 SASI_Mm01_00143265 predicted 2750
11 SASI_Mm01_00143261 predicted 1670
12 SASI_Mm01_00143266 predicted 2675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182530
MYRFL MISSION shRNA Bacterial Glycerol Stock
myelin regulatory factor-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-727s1c1
Sequence:CCGGCACACCCACCAATGTCAAGTTCTCGAGAACTTGACATTGGTGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-954s1c1
Sequence:CCGGCACCGGATTTAGCTGACTGTTCTCGAGAACAGTCAGCTAAATCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-490s1c1
Sequence:CCGGGCAAAGACAATCTGAGGAGAACTCGAGTTCTCCTCAGATTGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-626s1c1
Sequence:CCGGCAGATTATGGAAATCCAGCAACTCGAGTTGCTGGATTTCCATAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-473s1c1
Sequence:CCGGGTCTCTTCAAGTCCTGTGCAACTCGAGTTGCACAGGACTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182530
MYRFL MISSION shRNA shRNA Plasmid DNA
myelin regulatory factor-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-727s1c1
Sequence:CCGGCACACCCACCAATGTCAAGTTCTCGAGAACTTGACATTGGTGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-954s1c1
Sequence:CCGGCACCGGATTTAGCTGACTGTTCTCGAGAACAGTCAGCTAAATCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-490s1c1
Sequence:CCGGGCAAAGACAATCTGAGGAGAACTCGAGTTCTCCTCAGATTGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-626s1c1
Sequence:CCGGCAGATTATGGAAATCCAGCAACTCGAGTTGCTGGATTTCCATAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-473s1c1
Sequence:CCGGGTCTCTTCAAGTCCTGTGCAACTCGAGTTGCACAGGACTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182530
MYRFL MISSION shRNA Lentiviral Transduction Particles
myelin regulatory factor-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-727s1c1
Sequence:CCGGCACACCCACCAATGTCAAGTTCTCGAGAACTTGACATTGGTGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-954s1c1
Sequence:CCGGCACCGGATTTAGCTGACTGTTCTCGAGAACAGTCAGCTAAATCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-490s1c1
Sequence:CCGGGCAAAGACAATCTGAGGAGAACTCGAGTTCTCCTCAGATTGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-626s1c1
Sequence:CCGGCAGATTATGGAAATCCAGCAACTCGAGTTGCTGGATTTCCATAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182530.1-473s1c1
Sequence:CCGGGTCTCTTCAAGTCCTGTGCAACTCGAGTTGCACAGGACTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033333
MYRFL MISSION shRNA Bacterial Glycerol Stock
myelin regulatory factor-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2622s21c1
Sequence:CCGGCACACCCACCAACGTCAAATTCTCGAGAATTTGACGTTGGTGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2808s21c1
Sequence:CCGGCTCCGACAGCGCATACCATTTCTCGAGAAATGGTATGCGCTGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2914s21c1
Sequence:CCGGTATCGACGTTGTAACTAATTTCTCGAGAAATTAGTTACAACGTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2139s21c1
Sequence:CCGGCCTCTACATACTTAGCTTAAACTCGAGTTTAAGCTAAGTATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033333.3-2942s21c1
Sequence:CCGGTTTGAGGAGGACATTACCACACTCGAGTGTGGTAATGTCCTCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033333
MYRFL MISSION shRNA shRNA Plasmid DNA
myelin regulatory factor-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2622s21c1
Sequence:CCGGCACACCCACCAACGTCAAATTCTCGAGAATTTGACGTTGGTGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2808s21c1
Sequence:CCGGCTCCGACAGCGCATACCATTTCTCGAGAAATGGTATGCGCTGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2914s21c1
Sequence:CCGGTATCGACGTTGTAACTAATTTCTCGAGAAATTAGTTACAACGTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2139s21c1
Sequence:CCGGCCTCTACATACTTAGCTTAAACTCGAGTTTAAGCTAAGTATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033333.3-2942s21c1
Sequence:CCGGTTTGAGGAGGACATTACCACACTCGAGTGTGGTAATGTCCTCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033333
MYRFL MISSION shRNA Lentiviral Transduction Particles
myelin regulatory factor-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2622s21c1
Sequence:CCGGCACACCCACCAACGTCAAATTCTCGAGAATTTGACGTTGGTGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2808s21c1
Sequence:CCGGCTCCGACAGCGCATACCATTTCTCGAGAAATGGTATGCGCTGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2914s21c1
Sequence:CCGGTATCGACGTTGTAACTAATTTCTCGAGAAATTAGTTACAACGTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033333.3-2139s21c1
Sequence:CCGGCCTCTACATACTTAGCTTAAACTCGAGTTTAAGCTAAGTATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033333.3-2942s21c1
Sequence:CCGGTTTGAGGAGGACATTACCACACTCGAGTGTGGTAATGTCCTCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks