EMAIL THIS PAGE TO A FRIEND

MZT1

mitotic spindle organizing protein 1

Synonyms: C13orf37 MOZART1
UniProtKB ID: Q08AG7, Q5W0P5
Gene ID:
Mouse(76789) mitotic spindle organizing protein 1
Rat(692032) mitotic spindle organizing protein 1
chicken(418822) mitotic spindle organizing protein 1
cow(615784) mitotic spindle organizing protein 1
dog(100683696) mitotic spindle organizing protein 1
domestic guinea pig(100731506) mitotic spindle organizing protein 1
naked mole-rat(101723923) mitotic spindle organizing protein 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001071775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001071775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001071775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001071775 Rosetta Predictions human pricing
XM_495961 Rosetta Predictions human pricing
XM_933946 Rosetta Predictions human pricing
XM_001081273 Rosetta Predictions rat pricing
NM_175245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001071775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311893 predicted 635
2 SASI_Hs02_00311894 predicted 449
3 SASI_Hs02_00311895 predicted 600
4 SASI_Hs02_00311896 predicted 686
5 SASI_Hs02_00311897 predicted 496
6 SASI_Hs02_00311898 predicted 622
7 SASI_Hs02_00311899 predicted 616
8 SASI_Hs02_00311900 predicted 711
9 SASI_Hs02_00311901 predicted 679
10 SASI_Hs02_00311902 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276172 predicted 631
2 SASI_Hs01_00276173 predicted 441
3 SASI_Hs01_00276174 predicted 589
4 SASI_Hs01_00276175 predicted 676
5 SASI_Hs01_00276176 predicted 483
6 SASI_Hs01_00276177 predicted 817
7 SASI_Hs01_00276178 predicted 612
8 SASI_Hs01_00276179 predicted 609
9 SASI_Hs01_00276180 predicted 675
10 SASI_Hs01_00276181 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249865 predicted 120
2 SASI_Hs01_00249866 predicted 184
3 SASI_Hs01_00249867 predicted 92
4 SASI_Hs01_00249868 predicted 299
5 SASI_Hs01_00249869 predicted 273
6 SASI_Hs01_00249870 predicted 31
7 SASI_Hs01_00249871 predicted 163
8 SASI_Hs01_00249872 predicted 74
9 SASI_Hs01_00249873 predicted 305
10 SASI_Hs01_00249874 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371305 predicted 786
2 SASI_Rn02_00371306 predicted 679
3 SASI_Rn02_00371307 predicted 247
4 SASI_Rn02_00371308 predicted 498
5 SASI_Rn02_00371309 predicted 551
6 SASI_Rn02_00371310 predicted 234
7 SASI_Rn02_00371311 predicted 688
8 SASI_Rn02_00371312 predicted 782
9 SASI_Rn02_00371313 predicted 240
10 SASI_Rn02_00371314 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345928 predicted 500
2 SASI_Mm02_00345929 predicted 468
3 SASI_Mm02_00345930 predicted 403
4 SASI_Mm02_00345931 predicted 422
5 SASI_Mm02_00345932 predicted 567
6 SASI_Mm02_00345933 predicted 210
7 SASI_Mm02_00345934 predicted 577
8 SASI_Mm02_00345935 predicted 586
9 SASI_Mm02_00345936 predicted 305
10 SASI_Mm02_00345937 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001071775
VALIDATED
MZT1 MISSION shRNA Bacterial Glycerol Stock
mitotic spindle organizing protein 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-346s21c1
Sequence:CCGGCTTTGTGAACAAGGAATTAACCTCGAGGTTAATTCCTTGTTCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-1144s21c1
Sequence:CCGGCAATGCTTAGGTTAGTATTATCTCGAGATAATACTAACCTAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-300s21c1
Sequence:CCGGTTTGAATACTGGCTTAGATATCTCGAGATATCTAAGCCAGTATTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-370s21c1
Sequence:CCGGGAAGCTTTATCATCGGTTATTCTCGAGAATAACCGATGATAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001071775
VALIDATED
MZT1 MISSION shRNA shRNA Plasmid DNA
mitotic spindle organizing protein 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-346s21c1
Sequence:CCGGCTTTGTGAACAAGGAATTAACCTCGAGGTTAATTCCTTGTTCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-1144s21c1
Sequence:CCGGCAATGCTTAGGTTAGTATTATCTCGAGATAATACTAACCTAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-300s21c1
Sequence:CCGGTTTGAATACTGGCTTAGATATCTCGAGATATCTAAGCCAGTATTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-370s21c1
Sequence:CCGGGAAGCTTTATCATCGGTTATTCTCGAGAATAACCGATGATAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001071775
VALIDATED
MZT1 MISSION shRNA Lentiviral Transduction Particles
mitotic spindle organizing protein 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-346s21c1
Sequence:CCGGCTTTGTGAACAAGGAATTAACCTCGAGGTTAATTCCTTGTTCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-1144s21c1
Sequence:CCGGCAATGCTTAGGTTAGTATTATCTCGAGATAATACTAACCTAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-300s21c1
Sequence:CCGGTTTGAATACTGGCTTAGATATCTCGAGATATCTAAGCCAGTATTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001071775.2-370s21c1
Sequence:CCGGGAAGCTTTATCATCGGTTATTCTCGAGAATAACCGATGATAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175245
VALIDATED
MZT1 MISSION shRNA Bacterial Glycerol Stock
mitotic spindle organizing protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000179730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-128s1c1
Sequence:CCGGGATATGGAAACGCTGTCTATTCTCGAGAATAGACAGCGTTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-134s1c1
Sequence:CCGGGAAACGCTGTCTATTTGTGTACTCGAGTACACAAATAGACAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175245.2-157s1c1
Sequence:CCGGGCTTTGTGAACAAGGAATCAACTCGAGTTGATTCCTTGTTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-182s1c1
Sequence:CCGGGAAGCCTTATCGTCTGTTATTCTCGAGAATAACAGACGATAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175245
VALIDATED
MZT1 MISSION shRNA shRNA Plasmid DNA
mitotic spindle organizing protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000179730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-128s1c1
Sequence:CCGGGATATGGAAACGCTGTCTATTCTCGAGAATAGACAGCGTTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-134s1c1
Sequence:CCGGGAAACGCTGTCTATTTGTGTACTCGAGTACACAAATAGACAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175245.2-157s1c1
Sequence:CCGGGCTTTGTGAACAAGGAATCAACTCGAGTTGATTCCTTGTTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-182s1c1
Sequence:CCGGGAAGCCTTATCGTCTGTTATTCTCGAGAATAACAGACGATAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175245
VALIDATED
MZT1 MISSION shRNA Lentiviral Transduction Particles
mitotic spindle organizing protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000179730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-128s1c1
Sequence:CCGGGATATGGAAACGCTGTCTATTCTCGAGAATAGACAGCGTTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-134s1c1
Sequence:CCGGGAAACGCTGTCTATTTGTGTACTCGAGTACACAAATAGACAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175245.2-157s1c1
Sequence:CCGGGCTTTGTGAACAAGGAATCAACTCGAGTTGATTCCTTGTTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175245.2-182s1c1
Sequence:CCGGGAAGCCTTATCGTCTGTTATTCTCGAGAATAACAGACGATAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks