EMAIL THIS PAGE TO A FRIEND

NAA20

N(alpha)-acetyltransferase 20, NatB catalytic subunit

Synonyms: NAT3 NAT5 dJ1002M8.1
Gene ID:
Human(51126) Summary: NAT5 is a component of N-acetyltransferase complex B (NatB). Human NatB performs cotranslational N(alpha)-terminal acetylation of methionine residues when they are followed by asparagine (Starheim et al., 2008 [PubMed 18570629]
Mouse(67877) N(alpha)-acetyltransferase 20, NatB catalytic subunit
Rat(362228) N(alpha)-acetyltransferase 20, NatB catalytic subunit
naked mole-rat(101725350) N(alpha)-acetyltransferase 20, NatB catalytic subunit
domestic guinea pig(100716010) N(alpha)-acetyltransferase 20, NatB catalytic subunit
sheep(101123573) N(alpha)-acetyltransferase 20, NatB catalytic subunit
Zebrafish(541516) N(alpha)-acetyltransferase 20, NatB catalytic subunit
chicken(424333) N(alpha)-acetyltransferase 20, NatB catalytic subunit
cow(540212) N(alpha)-acetyltransferase 20, NatB catalytic subunit
domestic cat(101082645) N(alpha)-acetyltransferase 20, NatB catalytic subunit
dog(477138) N(alpha)-acetyltransferase 20, NatB catalytic subunit
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016100 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016100 Rosetta Predictions human pricing
NM_181527 Rosetta Predictions human pricing
NM_181528 Rosetta Predictions human pricing
NM_001108595 Rosetta Predictions rat pricing
NM_026425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214703 predicted 784
2 SASI_Hs01_00214704 predicted 799
3 SASI_Hs01_00214705 predicted 813
4 SASI_Hs01_00214706 predicted 821
5 SASI_Hs01_00214707 predicted 789
6 SASI_Hs01_00214709 predicted 764
7 SASI_Hs01_00214710 predicted 801
8 SASI_Hs01_00214711 predicted 801
9 SASI_Hs01_00214712 predicted 820
10 SASI_Hs02_00348871 predicted 816
11 SASI_Hs01_00214708 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056625 predicted 772
2 SASI_Hs01_00056626 predicted 784
3 SASI_Hs01_00056627 predicted 799
4 SASI_Hs01_00056628 predicted 800
5 SASI_Hs01_00056629 predicted 766
6 SASI_Hs01_00056631 predicted 747
7 SASI_Hs01_00056632 predicted 788
8 SASI_Hs01_00056633 predicted 783
9 SASI_Hs01_00056634 predicted 809
10 SASI_Hs02_00370145 predicted 798
11 SASI_Hs01_00056630 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209776 predicted 647
2 SASI_Hs01_00209777 predicted 653
3 SASI_Hs01_00209778 predicted 673
4 SASI_Hs01_00209779 predicted 674
5 SASI_Hs01_00209780 predicted 641
6 SASI_Hs01_00209782 predicted 614
7 SASI_Hs01_00209783 predicted 655
8 SASI_Hs01_00209784 predicted 653
9 SASI_Hs01_00209785 predicted 672
10 SASI_Hs02_00370146 predicted 667
11 SASI_Hs01_00209781 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240189 predicted 462
2 SASI_Rn02_00240190 predicted 639
3 SASI_Rn02_00240191 predicted 725
4 SASI_Rn02_00240192 predicted 438
5 SASI_Rn02_00240193 predicted 297
6 SASI_Rn02_00240194 predicted 349
7 SASI_Rn02_00240195 predicted 453
8 SASI_Rn02_00240196 predicted 378
9 SASI_Rn02_00240197 predicted 598
10 SASI_Rn02_00240198 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115090 predicted 530
2 SASI_Mm01_00115091 predicted 633
3 SASI_Mm01_00115092 predicted 267
4 SASI_Mm01_00115093 predicted 348
5 SASI_Mm01_00115094 predicted 434
6 SASI_Mm01_00115095 predicted 322
7 SASI_Mm01_00115096 predicted 698
8 SASI_Mm01_00115097 predicted 474
9 SASI_Mm01_00115098 predicted 627
10 SASI_Mm01_00115099 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026425
VALIDATED
NAA20 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 20, NatB catalytic subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026425.1-759s1c1
Sequence:CCGGCCTTCCAATGAGCAATAGCATCTCGAGATGCTATTGCTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-444s1c1
Sequence:CCGGGCAGTTGGGTTACAGTGTCTACTCGAGTAGACACTGTAACCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026425.1-191s1c1
Sequence:CCGGGCGGAGAACTAATGGGTTATACTCGAGTATAACCCATTAGTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-405s1c1
Sequence:CCGGCGTAAGAGTATCCAATCAAGTCTCGAGACTTGATTGGATACTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-78s1c1
Sequence:CCGGGTTCCGCTTCAACAACATTAACTCGAGTTAATGTTGTTGAAGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026425.3-785s21c1
Sequence:CCGGCCTTCCAATGAGCAATAGCATCTCGAGATGCTATTGCTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-105s21c1
Sequence:CCGGGTTCCGCTTCAACAACATTAACTCGAGTTAATGTTGTTGAAGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-218s21c1
Sequence:CCGGGCGGAGAACTAATGGGTTATACTCGAGTATAACCCATTAGTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-432s21c1
Sequence:CCGGCGTAAGAGTATCCAATCAAGTCTCGAGACTTGATTGGATACTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026425
VALIDATED
NAA20 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 20, NatB catalytic subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026425.1-759s1c1
Sequence:CCGGCCTTCCAATGAGCAATAGCATCTCGAGATGCTATTGCTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-444s1c1
Sequence:CCGGGCAGTTGGGTTACAGTGTCTACTCGAGTAGACACTGTAACCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026425.1-191s1c1
Sequence:CCGGGCGGAGAACTAATGGGTTATACTCGAGTATAACCCATTAGTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-405s1c1
Sequence:CCGGCGTAAGAGTATCCAATCAAGTCTCGAGACTTGATTGGATACTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-78s1c1
Sequence:CCGGGTTCCGCTTCAACAACATTAACTCGAGTTAATGTTGTTGAAGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026425.3-785s21c1
Sequence:CCGGCCTTCCAATGAGCAATAGCATCTCGAGATGCTATTGCTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-105s21c1
Sequence:CCGGGTTCCGCTTCAACAACATTAACTCGAGTTAATGTTGTTGAAGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-218s21c1
Sequence:CCGGGCGGAGAACTAATGGGTTATACTCGAGTATAACCCATTAGTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-432s21c1
Sequence:CCGGCGTAAGAGTATCCAATCAAGTCTCGAGACTTGATTGGATACTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026425
VALIDATED
NAA20 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 20, NatB catalytic subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026425.1-759s1c1
Sequence:CCGGCCTTCCAATGAGCAATAGCATCTCGAGATGCTATTGCTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-444s1c1
Sequence:CCGGGCAGTTGGGTTACAGTGTCTACTCGAGTAGACACTGTAACCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026425.1-191s1c1
Sequence:CCGGGCGGAGAACTAATGGGTTATACTCGAGTATAACCCATTAGTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-405s1c1
Sequence:CCGGCGTAAGAGTATCCAATCAAGTCTCGAGACTTGATTGGATACTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026425.1-78s1c1
Sequence:CCGGGTTCCGCTTCAACAACATTAACTCGAGTTAATGTTGTTGAAGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026425.3-785s21c1
Sequence:CCGGCCTTCCAATGAGCAATAGCATCTCGAGATGCTATTGCTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-105s21c1
Sequence:CCGGGTTCCGCTTCAACAACATTAACTCGAGTTAATGTTGTTGAAGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-218s21c1
Sequence:CCGGGCGGAGAACTAATGGGTTATACTCGAGTATAACCCATTAGTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026425.3-432s21c1
Sequence:CCGGCGTAAGAGTATCCAATCAAGTCTCGAGACTTGATTGGATACTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016100
VALIDATED
NAA20 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 20, NatB catalytic subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-369s1c1
Sequence:CCGGGCTGCTAAACTTATGGAGTTACTCGAGTAACTCCATAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-574s1c1
Sequence:CCGGCCAGGGATACTGAGAAGAAATCTCGAGATTTCTTCTCAGTATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-546s1c1
Sequence:CCGGGACGCTTATGATATGAGGAAACTCGAGTTTCCTCATATCATAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-253s1c1
Sequence:CCGGGTGGAGAATTAATGGGTTATACTCGAGTATAACCCATTAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-143s1c1
Sequence:CCGGCCGCTTCAACAACATTAACTTCTCGAGAAGTTAATGTTGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-253s21c1
Sequence:CCGGGTGGAGAATTAATGGGTTATACTCGAGTATAACCCATTAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-574s21c1
Sequence:CCGGCCAGGGATACTGAGAAGAAATCTCGAGATTTCTTCTCAGTATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-143s21c1
Sequence:CCGGCCGCTTCAACAACATTAACTTCTCGAGAAGTTAATGTTGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-369s21c1
Sequence:CCGGGCTGCTAAACTTATGGAGTTACTCGAGTAACTCCATAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-546s21c1
Sequence:CCGGGACGCTTATGATATGAGGAAACTCGAGTTTCCTCATATCATAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016100
VALIDATED
NAA20 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 20, NatB catalytic subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-369s1c1
Sequence:CCGGGCTGCTAAACTTATGGAGTTACTCGAGTAACTCCATAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-574s1c1
Sequence:CCGGCCAGGGATACTGAGAAGAAATCTCGAGATTTCTTCTCAGTATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-546s1c1
Sequence:CCGGGACGCTTATGATATGAGGAAACTCGAGTTTCCTCATATCATAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-253s1c1
Sequence:CCGGGTGGAGAATTAATGGGTTATACTCGAGTATAACCCATTAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-143s1c1
Sequence:CCGGCCGCTTCAACAACATTAACTTCTCGAGAAGTTAATGTTGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-253s21c1
Sequence:CCGGGTGGAGAATTAATGGGTTATACTCGAGTATAACCCATTAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-574s21c1
Sequence:CCGGCCAGGGATACTGAGAAGAAATCTCGAGATTTCTTCTCAGTATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-143s21c1
Sequence:CCGGCCGCTTCAACAACATTAACTTCTCGAGAAGTTAATGTTGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-369s21c1
Sequence:CCGGGCTGCTAAACTTATGGAGTTACTCGAGTAACTCCATAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-546s21c1
Sequence:CCGGGACGCTTATGATATGAGGAAACTCGAGTTTCCTCATATCATAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016100
VALIDATED
NAA20 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 20, NatB catalytic subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-369s1c1
Sequence:CCGGGCTGCTAAACTTATGGAGTTACTCGAGTAACTCCATAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-574s1c1
Sequence:CCGGCCAGGGATACTGAGAAGAAATCTCGAGATTTCTTCTCAGTATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-546s1c1
Sequence:CCGGGACGCTTATGATATGAGGAAACTCGAGTTTCCTCATATCATAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-253s1c1
Sequence:CCGGGTGGAGAATTAATGGGTTATACTCGAGTATAACCCATTAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016100.2-143s1c1
Sequence:CCGGCCGCTTCAACAACATTAACTTCTCGAGAAGTTAATGTTGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-253s21c1
Sequence:CCGGGTGGAGAATTAATGGGTTATACTCGAGTATAACCCATTAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-574s21c1
Sequence:CCGGCCAGGGATACTGAGAAGAAATCTCGAGATTTCTTCTCAGTATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-143s21c1
Sequence:CCGGCCGCTTCAACAACATTAACTTCTCGAGAAGTTAATGTTGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-369s21c1
Sequence:CCGGGCTGCTAAACTTATGGAGTTACTCGAGTAACTCCATAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016100.3-546s21c1
Sequence:CCGGGACGCTTATGATATGAGGAAACTCGAGTTTCCTCATATCATAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks