EMAIL THIS PAGE TO A FRIEND

NAALAD2

N-acetylated alpha-linked acidic dipeptidase 2

Synonyms: GCPIII GPCIII NAADALASE2 NAALADASE2
UniProtKB ID: Q9Y3Q0, B3KQR4, Q4VAM9
Gene ID:
Human(10003) Summary: This gene is a member of the N-acetylated alpha-linked acidic dipeptidase (NAALADase) gene family. The representative member of this family is the gene encoding human prostate-specific membrane antigen (PSM), which is a marker of prostatic carcinomas and is the first to be shown to possess NAALADase activity. NAALADase cleaves N-acetyl-L-aspartate-L-glutamate (NAAG), which is a neuropeptide expressed both in the central nervous systems and in the periphery and is thought to function as a neurotransmitter. The product of this gene is a type II integral membrane protein. Transient transfection of this gene confers both NAALADase and dipetidyl peptidase IV activities to mammalian cells. This gene is highly expressed in ovary and testis as well as within discrete brain areas. [provided by RefSeq, Jul 2008]
Mouse(72560) N-acetylated alpha-linked acidic dipeptidase 2
Rat(300384) N-acetylated alpha-linked acidic dipeptidase 2
sheep(101120451) N-acetylated alpha-linked acidic dipeptidase 2
domestic guinea pig(100726280) N-acetylated alpha-linked acidic dipeptidase 2
naked mole-rat(101722660) N-acetylated alpha-linked acidic dipeptidase 2
Domestic Rabbit(100339446) N-acetylated alpha-linked acidic dipeptidase 2
chicken(419010) N-acetylated alpha-linked acidic dipeptidase 2
dog(485139) N-acetylated alpha-linked acidic dipeptidase 2
domestic cat(101089389) N-acetylated alpha-linked acidic dipeptidase 2
cow(536439) N-acetylated alpha-linked acidic dipeptidase 2
Horse(100050187) N-acetylated alpha-linked acidic dipeptidase 2
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005467 Rosetta Predictions human pricing
NM_001106802 Rosetta Predictions rat pricing
NM_028279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190287 predicted 979
2 SASI_Hs02_00339631 predicted 1081
3 SASI_Hs01_00190288 predicted 1040
4 SASI_Hs01_00190290 predicted 2125
5 SASI_Hs01_00190291 predicted 655
6 SASI_Hs01_00190292 predicted 1069
7 SASI_Hs01_00190293 predicted 1633
8 SASI_Hs01_00190295 predicted 1868
9 SASI_Hs01_00190296 predicted 2016
10 SASI_Hs02_00339632 predicted 962
11 SASI_Hs01_00190289 predicted 317
12 SASI_Hs01_00190294 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222548 predicted 1963
2 SASI_Rn02_00222549 predicted 2185
3 SASI_Rn02_00222550 predicted 1144
4 SASI_Rn02_00222551 predicted 1677
5 SASI_Rn02_00222552 predicted 1283
6 SASI_Rn02_00222553 predicted 426
7 SASI_Rn02_00222554 predicted 2273
8 SASI_Rn02_00222555 predicted 2382
9 SASI_Rn02_00222556 predicted 2322
10 SASI_Rn02_00222557 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070703 predicted 1991
2 SASI_Mm01_00070704 predicted 323
3 SASI_Mm01_00070705 predicted 1389
4 SASI_Mm01_00070707 predicted 1645
5 SASI_Mm01_00070708 predicted 840
6 SASI_Mm01_00070709 predicted 1964
7 SASI_Mm01_00070710 predicted 889
8 SASI_Mm02_00333637 predicted 1883
9 SASI_Mm01_00070711 predicted 624
10 SASI_Mm01_00070712 predicted 1787
11 SASI_Mm01_00070706 predicted 989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028279
NAALAD2 MISSION shRNA Bacterial Glycerol Stock
N-acetylated alpha-linked acidic dipeptidase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-775s1c1
Sequence:CCGGGCAGAAGTGAAGAAACATATTCTCGAGAATATGTTTCTTCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-205s1c1
Sequence:CCGGCGCTACACTAAGAACAAGAAACTCGAGTTTCTTGTTCTTAGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-247s1c1
Sequence:CCGGCCTGTATATCATACCATCTATCTCGAGATAGATGGTATGATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-606s1c1
Sequence:CCGGGCTTCTTGAAAGAGCATTCATCTCGAGATGAATGCTCTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-475s1c1
Sequence:CCGGGCAGTGTCATTTGATCCCTTACTCGAGTAAGGGATCAAATGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028279
NAALAD2 MISSION shRNA shRNA Plasmid DNA
N-acetylated alpha-linked acidic dipeptidase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-775s1c1
Sequence:CCGGGCAGAAGTGAAGAAACATATTCTCGAGAATATGTTTCTTCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-205s1c1
Sequence:CCGGCGCTACACTAAGAACAAGAAACTCGAGTTTCTTGTTCTTAGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-247s1c1
Sequence:CCGGCCTGTATATCATACCATCTATCTCGAGATAGATGGTATGATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-606s1c1
Sequence:CCGGGCTTCTTGAAAGAGCATTCATCTCGAGATGAATGCTCTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-475s1c1
Sequence:CCGGGCAGTGTCATTTGATCCCTTACTCGAGTAAGGGATCAAATGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028279
NAALAD2 MISSION shRNA Lentiviral Transduction Particles
N-acetylated alpha-linked acidic dipeptidase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-775s1c1
Sequence:CCGGGCAGAAGTGAAGAAACATATTCTCGAGAATATGTTTCTTCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-205s1c1
Sequence:CCGGCGCTACACTAAGAACAAGAAACTCGAGTTTCTTGTTCTTAGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-247s1c1
Sequence:CCGGCCTGTATATCATACCATCTATCTCGAGATAGATGGTATGATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-606s1c1
Sequence:CCGGGCTTCTTGAAAGAGCATTCATCTCGAGATGAATGCTCTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028279.1-475s1c1
Sequence:CCGGGCAGTGTCATTTGATCCCTTACTCGAGTAAGGGATCAAATGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005467
NAALAD2 MISSION shRNA Bacterial Glycerol Stock
N-acetylated alpha-linked acidic dipeptidase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1620s1c1
Sequence:CCGGCCGTTACACTAAGAATAAGAACTCGAGTTCTTATTCTTAGTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005467.2-2761s1c1
Sequence:CCGGCGAATGTATAAACTGTGGTATCTCGAGATACCACAGTTTATACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1671s1c1
Sequence:CCGGCCACACAATTTATGAGACATTCTCGAGAATGTCTCATAAATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1960s1c1
Sequence:CCGGCGACTTATACAAGTTGATCTTCTCGAGAAGATCAACTTGTATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-166s1c1
Sequence:CCGGGTGCGCTATCATCAAAGTATACTCGAGTATACTTTGATGATAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005467
NAALAD2 MISSION shRNA shRNA Plasmid DNA
N-acetylated alpha-linked acidic dipeptidase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1620s1c1
Sequence:CCGGCCGTTACACTAAGAATAAGAACTCGAGTTCTTATTCTTAGTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005467.2-2761s1c1
Sequence:CCGGCGAATGTATAAACTGTGGTATCTCGAGATACCACAGTTTATACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1671s1c1
Sequence:CCGGCCACACAATTTATGAGACATTCTCGAGAATGTCTCATAAATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1960s1c1
Sequence:CCGGCGACTTATACAAGTTGATCTTCTCGAGAAGATCAACTTGTATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-166s1c1
Sequence:CCGGGTGCGCTATCATCAAAGTATACTCGAGTATACTTTGATGATAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005467
NAALAD2 MISSION shRNA Lentiviral Transduction Particles
N-acetylated alpha-linked acidic dipeptidase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1620s1c1
Sequence:CCGGCCGTTACACTAAGAATAAGAACTCGAGTTCTTATTCTTAGTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005467.2-2761s1c1
Sequence:CCGGCGAATGTATAAACTGTGGTATCTCGAGATACCACAGTTTATACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1671s1c1
Sequence:CCGGCCACACAATTTATGAGACATTCTCGAGAATGTCTCATAAATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-1960s1c1
Sequence:CCGGCGACTTATACAAGTTGATCTTCTCGAGAAGATCAACTTGTATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005467.2-166s1c1
Sequence:CCGGGTGCGCTATCATCAAAGTATACTCGAGTATACTTTGATGATAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks