EMAIL THIS PAGE TO A FRIEND

NAALADL1

N-acetylated alpha-linked acidic dipeptidase-like 1

Synonyms: I100 NAALADASEL
UniProtKB ID: Q9UQQ1, C9J8A1, C9J964, C9JL35, C9JSN0, O43176
Gene ID:
Mouse(381204) N-acetylated alpha-linked acidic dipeptidase-like 1
Rat(83568) N-acetylated alpha-linked acidic dipeptidase-like 1
cow(506692) N-acetylated alpha-linked acidic dipeptidase-like 1
domestic cat(101082777) N-acetylated alpha-linked acidic dipeptidase-like 1
dog(483751) N-acetylated alpha-linked acidic dipeptidase-like 1
naked mole-rat(101702083) N-acetylated alpha-linked acidic dipeptidase-like 1
domestic guinea pig(100724644) N-acetylated alpha-linked acidic dipeptidase-like 1
sheep(101105198) N-acetylated alpha-linked acidic dipeptidase-like 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022231 MISSION® esiRNA esiRNA targeting mouse Naaladl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005468 Rosetta Predictions human pricing
NM_031759 Rosetta Predictions rat pricing
XM_579530 Rosetta Predictions rat pricing
NM_001009546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120162 predicted 1648
2 SASI_Hs01_00120163 predicted 889
3 SASI_Hs01_00120164 predicted 444
4 SASI_Hs01_00120165 predicted 2263
5 SASI_Hs01_00120166 predicted 2176
6 SASI_Hs01_00120167 predicted 1264
7 SASI_Hs01_00120168 predicted 1922
8 SASI_Hs01_00120169 predicted 1005
9 SASI_Hs01_00120170 predicted 885
10 SASI_Hs01_00120171 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095519 predicted 472
2 SASI_Rn01_00095520 predicted 998
3 SASI_Rn01_00095521 predicted 2064
4 SASI_Rn01_00095522 predicted 1677
5 SASI_Rn01_00095523 predicted 853
6 SASI_Rn01_00095524 predicted 1417
7 SASI_Rn01_00095525 predicted 1572
8 SASI_Rn01_00095526 predicted 1864
9 SASI_Rn01_00095527 predicted 380
10 SASI_Rn02_00265175 predicted 199
11 SASI_Rn01_00095528 predicted 2308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151430 predicted 1427
2 SASI_Rn01_00151431 predicted 1044
3 SASI_Rn01_00151432 predicted 1173
4 SASI_Rn01_00151433 predicted 1340
5 SASI_Rn01_00151434 predicted 939
6 SASI_Rn01_00151435 predicted 1231
7 SASI_Rn01_00151436 predicted 1033
8 SASI_Rn01_00151437 predicted 1674
9 SASI_Rn01_00151438 predicted 1411
10 SASI_Rn01_00151439 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071991 predicted 538
2 SASI_Mm01_00071992 predicted 441
3 SASI_Mm02_00286854 predicted 1396
4 SASI_Mm01_00071993 predicted 888
5 SASI_Mm01_00071995 predicted 630
6 SASI_Mm01_00071996 predicted 354
7 SASI_Mm01_00071997 predicted 484
8 SASI_Mm01_00071998 predicted 897
9 SASI_Mm01_00071999 predicted 1648
10 SASI_Mm01_00072000 predicted 825
11 SASI_Mm01_00071994 predicted 875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005468
NAALADL1 MISSION shRNA Bacterial Glycerol Stock
N-acetylated alpha-linked acidic dipeptidase-like 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-446s1c1
Sequence:CCGGCCAGATGTGGTACAACCCTATCTCGAGATAGGGTTGTACCACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-558s1c1
Sequence:CCGGGCATCAAACTTGAAGGCACCACTCGAGTGGTGCCTTCAAGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-754s1c1
Sequence:CCGGAGGCTCCTACTACGAGTATTTCTCGAGAAATACTCGTAGTAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-1975s1c1
Sequence:CCGGGATGCTCAATGACCAGTTGATCTCGAGATCAACTGGTCATTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-1226s1c1
Sequence:CCGGCCTCGCAGATCAATCGTGTTTCTCGAGAAACACGATTGATCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005468.2-902s21c1
Sequence:CCGGTGTAACCTCAACGGAACTTTGCTCGAGCAAAGTTCCGTTGAGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005468
NAALADL1 MISSION shRNA shRNA Plasmid DNA
N-acetylated alpha-linked acidic dipeptidase-like 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-446s1c1
Sequence:CCGGCCAGATGTGGTACAACCCTATCTCGAGATAGGGTTGTACCACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-558s1c1
Sequence:CCGGGCATCAAACTTGAAGGCACCACTCGAGTGGTGCCTTCAAGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-754s1c1
Sequence:CCGGAGGCTCCTACTACGAGTATTTCTCGAGAAATACTCGTAGTAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-1975s1c1
Sequence:CCGGGATGCTCAATGACCAGTTGATCTCGAGATCAACTGGTCATTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-1226s1c1
Sequence:CCGGCCTCGCAGATCAATCGTGTTTCTCGAGAAACACGATTGATCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005468.2-902s21c1
Sequence:CCGGTGTAACCTCAACGGAACTTTGCTCGAGCAAAGTTCCGTTGAGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005468
NAALADL1 MISSION shRNA Lentiviral Transduction Particles
N-acetylated alpha-linked acidic dipeptidase-like 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-446s1c1
Sequence:CCGGCCAGATGTGGTACAACCCTATCTCGAGATAGGGTTGTACCACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-558s1c1
Sequence:CCGGGCATCAAACTTGAAGGCACCACTCGAGTGGTGCCTTCAAGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-754s1c1
Sequence:CCGGAGGCTCCTACTACGAGTATTTCTCGAGAAATACTCGTAGTAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-1975s1c1
Sequence:CCGGGATGCTCAATGACCAGTTGATCTCGAGATCAACTGGTCATTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005468.1-1226s1c1
Sequence:CCGGCCTCGCAGATCAATCGTGTTTCTCGAGAAACACGATTGATCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005468.2-902s21c1
Sequence:CCGGTGTAACCTCAACGGAACTTTGCTCGAGCAAAGTTCCGTTGAGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355137
NAALADL1 MISSION shRNA Bacterial Glycerol Stock
N-acetylated alpha-linked acidic dipeptidase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-699s1c1
Sequence:CCGGGCCTAATGAAACCTTCCCAAACTCGAGTTTGGGAAGGTTTCATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-1095s1c1
Sequence:CCGGTCGATACGTGATCTACGGAAACTCGAGTTTCCGTAGATCACGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-1841s1c1
Sequence:CCGGCCCAGTTAGAGAAACAGAACACTCGAGTGTTCTGTTTCTCTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-444s1c1
Sequence:CCGGGCCCAATGTATTGCAACCTTACTCGAGTAAGGTTGCAATACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-693s1c1
Sequence:CCGGGAGCTTGCCTAATGAAACCTTCTCGAGAAGGTTTCATTAGGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355137
NAALADL1 MISSION shRNA shRNA Plasmid DNA
N-acetylated alpha-linked acidic dipeptidase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-699s1c1
Sequence:CCGGGCCTAATGAAACCTTCCCAAACTCGAGTTTGGGAAGGTTTCATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-1095s1c1
Sequence:CCGGTCGATACGTGATCTACGGAAACTCGAGTTTCCGTAGATCACGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-1841s1c1
Sequence:CCGGCCCAGTTAGAGAAACAGAACACTCGAGTGTTCTGTTTCTCTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-444s1c1
Sequence:CCGGGCCCAATGTATTGCAACCTTACTCGAGTAAGGTTGCAATACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-693s1c1
Sequence:CCGGGAGCTTGCCTAATGAAACCTTCTCGAGAAGGTTTCATTAGGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355137
NAALADL1 MISSION shRNA Lentiviral Transduction Particles
N-acetylated alpha-linked acidic dipeptidase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-699s1c1
Sequence:CCGGGCCTAATGAAACCTTCCCAAACTCGAGTTTGGGAAGGTTTCATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-1095s1c1
Sequence:CCGGTCGATACGTGATCTACGGAAACTCGAGTTTCCGTAGATCACGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-1841s1c1
Sequence:CCGGCCCAGTTAGAGAAACAGAACACTCGAGTGTTCTGTTTCTCTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-444s1c1
Sequence:CCGGGCCCAATGTATTGCAACCTTACTCGAGTAAGGTTGCAATACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355137.2-693s1c1
Sequence:CCGGGAGCTTGCCTAATGAAACCTTCTCGAGAAGGTTTCATTAGGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks