EMAIL THIS PAGE TO A FRIEND

NAGK

N-acetylglucosamine kinase

Synonyms: GNK HSA242910
Gene ID:
Human(55577) Summary: This gene encodes a member of the N-acetylhexosamine kinase family. The encoded protein catalyzes the conversion of N-acetyl-D-glucosamine to N-acetyl-D-glucosamine 6-phosphate, and is the major mammalian enzyme which recovers amino sugars. [provided by RefSeq, Nov 2011]
Mouse(56174) N-acetylglucosamine kinase
Rat(297393) N-acetylglucosamine kinase
sheep(101102893) N-acetylglucosamine kinase
domestic guinea pig(100723449) N-acetylglucosamine kinase
naked mole-rat(101719840) N-acetylglucosamine kinase
Domestic Rabbit(100347215) N-acetylglucosamine kinase
Thale Cress(824923) acetylglutamate kinase
dog(492060) N-acetylglucosamine kinase
Horse(100050213) N-acetylglucosamine kinase
cow(508132) N-acetylglucosamine kinase
domestic cat(101098786) N-acetylglucosamine kinase
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017567 Rosetta Predictions human pricing
NM_001037768 Rosetta Predictions rat pricing
NM_019542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074163 predicted 641
2 SASI_Hs01_00074164 predicted 944
3 SASI_Hs01_00074165 predicted 746
4 SASI_Hs01_00074166 predicted 893
5 SASI_Hs01_00074167 predicted 478
6 SASI_Hs01_00074168 predicted 563
7 SASI_Hs01_00074169 predicted 503
8 SASI_Hs01_00074170 predicted 562
9 SASI_Hs01_00074171 predicted 638
10 SASI_Hs01_00074172 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037458 predicted 862
2 SASI_Rn01_00037459 predicted 921
3 SASI_Rn01_00037460 predicted 759
4 SASI_Rn01_00037461 predicted 309
5 SASI_Rn01_00037462 predicted 652
6 SASI_Rn01_00037464 predicted 474
7 SASI_Rn01_00037465 predicted 419
8 SASI_Rn01_00037466 predicted 762
9 SASI_Rn02_00204554 predicted 314
10 SASI_Rn02_00204555 predicted 428
11 SASI_Rn01_00037463 predicted 568
12 SASI_Rn01_00037467 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079125 predicted 316
2 SASI_Mm01_00079127 predicted 1087
3 SASI_Mm02_00324585 predicted 445
4 SASI_Mm01_00079128 predicted 933
5 SASI_Mm01_00079129 predicted 707
6 SASI_Mm01_00079130 predicted 823
7 SASI_Mm01_00079131 predicted 796
8 SASI_Mm01_00079132 predicted 208
9 SASI_Mm01_00079133 predicted 809
10 SASI_Mm01_00079134 predicted 656
11 SASI_Mm01_00079126 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017567
VALIDATED
NAGK MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosamine kinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-455s1c1
Sequence:CCGGGCAGATGGACTGAGCACAAACCTCGAGGTTTGTGCTCAGTCCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-434s1c1
Sequence:CCGGGATGGGAAGATCCTGGCAGAACTCGAGTTCTGCCAGGATCTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-1096s1c1
Sequence:CCGGCAGACACATCGTAGCAGTGTTCTCGAGAACACTGCTACGATGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-1365s1c1
Sequence:CCGGCCAATGCCATTGCCTTCTATTCTCGAGAATAGAAGGCAATGGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-308s1c1
Sequence:CCGGCCTGAGTGAAAGCTACTTAATCTCGAGATTAAGTAGCTTTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-999s1c1
Sequence:CCGGCCCATGGACTATAGCGCCAATCTCGAGATTGGCGCTATAGTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-483s1c1
Sequence:CCGGGCCTACTGGATCGCACACCAACTCGAGTTGGTGTGCGATCCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017567.1-369s1c1
Sequence:CCGGGATGGTGGGATTGTGCTCATACTCGAGTATGAGCACAATCCCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017567.1-621s1c1
Sequence:CCGGACTCACCTGTATAGGGACTTTCTCGAGAAAGTCCCTATACAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017567.3-1146s21c1
Sequence:GTACCGGTAGCAGTGTTGCCCGAGATTGCTCGAGCAATCTCGGGCAACACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017567
VALIDATED
NAGK MISSION shRNA shRNA Plasmid DNA
N-acetylglucosamine kinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-455s1c1
Sequence:CCGGGCAGATGGACTGAGCACAAACCTCGAGGTTTGTGCTCAGTCCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-434s1c1
Sequence:CCGGGATGGGAAGATCCTGGCAGAACTCGAGTTCTGCCAGGATCTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-1096s1c1
Sequence:CCGGCAGACACATCGTAGCAGTGTTCTCGAGAACACTGCTACGATGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-1365s1c1
Sequence:CCGGCCAATGCCATTGCCTTCTATTCTCGAGAATAGAAGGCAATGGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-308s1c1
Sequence:CCGGCCTGAGTGAAAGCTACTTAATCTCGAGATTAAGTAGCTTTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-999s1c1
Sequence:CCGGCCCATGGACTATAGCGCCAATCTCGAGATTGGCGCTATAGTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-483s1c1
Sequence:CCGGGCCTACTGGATCGCACACCAACTCGAGTTGGTGTGCGATCCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017567.1-369s1c1
Sequence:CCGGGATGGTGGGATTGTGCTCATACTCGAGTATGAGCACAATCCCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017567.1-621s1c1
Sequence:CCGGACTCACCTGTATAGGGACTTTCTCGAGAAAGTCCCTATACAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017567.3-1146s21c1
Sequence:GTACCGGTAGCAGTGTTGCCCGAGATTGCTCGAGCAATCTCGGGCAACACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017567
VALIDATED
NAGK MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosamine kinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-455s1c1
Sequence:CCGGGCAGATGGACTGAGCACAAACCTCGAGGTTTGTGCTCAGTCCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-434s1c1
Sequence:CCGGGATGGGAAGATCCTGGCAGAACTCGAGTTCTGCCAGGATCTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-1096s1c1
Sequence:CCGGCAGACACATCGTAGCAGTGTTCTCGAGAACACTGCTACGATGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017567.2-1365s1c1
Sequence:CCGGCCAATGCCATTGCCTTCTATTCTCGAGAATAGAAGGCAATGGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-308s1c1
Sequence:CCGGCCTGAGTGAAAGCTACTTAATCTCGAGATTAAGTAGCTTTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-999s1c1
Sequence:CCGGCCCATGGACTATAGCGCCAATCTCGAGATTGGCGCTATAGTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017567.1-483s1c1
Sequence:CCGGGCCTACTGGATCGCACACCAACTCGAGTTGGTGTGCGATCCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017567.1-369s1c1
Sequence:CCGGGATGGTGGGATTGTGCTCATACTCGAGTATGAGCACAATCCCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017567.1-621s1c1
Sequence:CCGGACTCACCTGTATAGGGACTTTCTCGAGAAAGTCCCTATACAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017567.3-1146s21c1
Sequence:GTACCGGTAGCAGTGTTGCCCGAGATTGCTCGAGCAATCTCGGGCAACACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019542
VALIDATED
NAGK MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosamine kinase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-764s1c1
Sequence:CCGGGCAGGCCATGTTCGACTATTTCTCGAGAAATAGTCGAACATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019542.1-937s1c1
Sequence:CCGGGCAGACATGTTGTGGCAGTATCTCGAGATACTGCCACAACATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-490s1c1
Sequence:CCGGGCTTTCCCAACCTGAGTGAAACTCGAGTTTCACTCAGGTTGGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-1127s1c1
Sequence:CCGGGTTGCGGCATTCTTCTGCATTCTCGAGAATGCAGAAGAATGCCGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.2-817s21c1
Sequence:CCGGACTTTGATAAATGCAAGTTTGCTCGAGCAAACTTGCATTTATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.2-869s21c1
Sequence:CCGGACATCAGGGAGACCCTCTTTCCTCGAGGAAAGAGGGTCTCCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019542.1-490s21c1
Sequence:CCGGGCTTTCCCAACCTGAGTGAAACTCGAGTTTCACTCAGGTTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-764s21c1
Sequence:CCGGGCAGGCCATGTTCGACTATTTCTCGAGAAATAGTCGAACATGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-821s21c1
Sequence:CCGGGTATAGGGACTTTGATAAATGCTCGAGCATTTATCAAAGTCCCTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-590s21c1
Sequence:CCGGAGGCTCCAACTGTAGGCTTATCTCGAGATAAGCCTACAGTTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019542.1-1127s21c1
Sequence:CCGGGTTGCGGCATTCTTCTGCATTCTCGAGAATGCAGAAGAATGCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019542
VALIDATED
NAGK MISSION shRNA shRNA Plasmid DNA
N-acetylglucosamine kinase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-764s1c1
Sequence:CCGGGCAGGCCATGTTCGACTATTTCTCGAGAAATAGTCGAACATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019542.1-937s1c1
Sequence:CCGGGCAGACATGTTGTGGCAGTATCTCGAGATACTGCCACAACATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-490s1c1
Sequence:CCGGGCTTTCCCAACCTGAGTGAAACTCGAGTTTCACTCAGGTTGGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-1127s1c1
Sequence:CCGGGTTGCGGCATTCTTCTGCATTCTCGAGAATGCAGAAGAATGCCGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.2-817s21c1
Sequence:CCGGACTTTGATAAATGCAAGTTTGCTCGAGCAAACTTGCATTTATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.2-869s21c1
Sequence:CCGGACATCAGGGAGACCCTCTTTCCTCGAGGAAAGAGGGTCTCCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019542.1-490s21c1
Sequence:CCGGGCTTTCCCAACCTGAGTGAAACTCGAGTTTCACTCAGGTTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-764s21c1
Sequence:CCGGGCAGGCCATGTTCGACTATTTCTCGAGAAATAGTCGAACATGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-821s21c1
Sequence:CCGGGTATAGGGACTTTGATAAATGCTCGAGCATTTATCAAAGTCCCTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-590s21c1
Sequence:CCGGAGGCTCCAACTGTAGGCTTATCTCGAGATAAGCCTACAGTTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019542.1-1127s21c1
Sequence:CCGGGTTGCGGCATTCTTCTGCATTCTCGAGAATGCAGAAGAATGCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019542
VALIDATED
NAGK MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosamine kinase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-764s1c1
Sequence:CCGGGCAGGCCATGTTCGACTATTTCTCGAGAAATAGTCGAACATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019542.1-937s1c1
Sequence:CCGGGCAGACATGTTGTGGCAGTATCTCGAGATACTGCCACAACATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-490s1c1
Sequence:CCGGGCTTTCCCAACCTGAGTGAAACTCGAGTTTCACTCAGGTTGGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019542.1-1127s1c1
Sequence:CCGGGTTGCGGCATTCTTCTGCATTCTCGAGAATGCAGAAGAATGCCGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.2-817s21c1
Sequence:CCGGACTTTGATAAATGCAAGTTTGCTCGAGCAAACTTGCATTTATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.2-869s21c1
Sequence:CCGGACATCAGGGAGACCCTCTTTCCTCGAGGAAAGAGGGTCTCCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019542.1-490s21c1
Sequence:CCGGGCTTTCCCAACCTGAGTGAAACTCGAGTTTCACTCAGGTTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-764s21c1
Sequence:CCGGGCAGGCCATGTTCGACTATTTCTCGAGAAATAGTCGAACATGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-821s21c1
Sequence:CCGGGTATAGGGACTTTGATAAATGCTCGAGCATTTATCAAAGTCCCTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019542.1-590s21c1
Sequence:CCGGAGGCTCCAACTGTAGGCTTATCTCGAGATAAGCCTACAGTTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019542.1-1127s21c1
Sequence:CCGGGTTGCGGCATTCTTCTGCATTCTCGAGAATGCAGAAGAATGCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks