EMAIL THIS PAGE TO A FRIEND

NAMPT

nicotinamide phosphoribosyltransferase

Synonyms: 1110035O14Rik PBEF PBEF1 VF VISFATIN
UniProtKB ID: P43490, A4D0Q9, A4D0R0, Q3KQV0, Q8WW95
Gene ID:
Human(10135) Summary: This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10. [provided by RefSeq, Feb 2011]
Mouse(59027) nicotinamide phosphoribosyltransferase
Rat(297508) nicotinamide phosphoribosyltransferase
chicken(417707) nicotinamide phosphoribosyltransferase
dog(483267) nicotinamide phosphoribosyltransferase
cow(520472) nicotinamide phosphoribosyltransferase
domestic cat(101081370) nicotinamide phosphoribosyltransferase
domestic guinea pig(100720344) nicotinamide phosphoribosyltransferase
naked mole-rat(101708723) nicotinamide phosphoribosyltransferase
Gene Class: Cytokines_and_Chemokines
191 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047776 Anti-NAMPT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA057722 Anti-NAMPT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2108566 Anti-PBEF1 IgG fraction of antiserum canine, rabbit, human, horse, bovine, canine, mouse, zebrafish, guinea pig
immunohistochemistry, western blot pricing
B5812 Anti-PBEF1 (161-173) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
B5937 Anti-PBEF1 (471-485) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV42254 Anti-PBEF1 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, zebrafish, guinea pig, canine, pig, rabbit, human, mouse, rat
western blot pricing
AV42255 Anti-PBEF1 (AB2) antibody produced in rabbit IgG fraction of antiserum pig, guinea pig, horse, canine, human, rat, rabbit, mouse
immunohistochemistry, western blot pricing
V9139 Anti-Visfatin (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse (predicted), human, rat
western blot pricing
SAB5300038 Monoclonal Anti-PBEF1 antibody produced in mouse clone 1D3A12, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005746 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182790 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005746 Rosetta Predictions human pricing
NM_182790 Rosetta Predictions human pricing
NM_177928 Rosetta Predictions rat pricing
NM_021524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340191 predicted 1290
2 SASI_Hs02_00340192 predicted 667
3 SASI_Hs02_00340193 predicted 1251
4 SASI_Hs02_00340194 predicted 550
5 SASI_Hs02_00340195 predicted 1391
6 SASI_Hs02_00340196 predicted 1531
7 SASI_Hs02_00340197 predicted 1206
8 SASI_Hs01_00013647 predicted 562
9 SASI_Hs02_00340198 predicted 1126
10 SASI_Hs01_00013649 predicted 959
11 SASI_Hs01_00013644 predicted 496
12 SASI_Hs01_00013645 predicted 445
13 SASI_Hs01_00013646 predicted 222
14 SASI_Hs01_00013648 predicted 849
15 SASI_Hs01_00013650 predicted 299
16 SASI_Hs01_00013651 predicted 334
17 SASI_Hs01_00013652 predicted 347
18 SASI_Hs01_00013653 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193388 predicted 507
2 SASI_Hs01_00193389 predicted 452
3 SASI_Hs01_00193390 predicted 227
4 SASI_Hs01_00193391 predicted 293
5 SASI_Hs01_00193392 predicted 858
6 SASI_Hs01_00193393 predicted 686
7 SASI_Hs01_00193394 predicted 313
8 SASI_Hs01_00193395 predicted 344
9 SASI_Hs01_00193396 predicted 360
10 SASI_Hs01_00193397 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115654 predicted 572
2 SASI_Rn01_00115655 predicted 894
3 SASI_Rn01_00115656 predicted 948
4 SASI_Rn02_00269589 predicted 828
5 SASI_Rn01_00115657 predicted 988
6 SASI_Rn01_00115658 predicted 208
7 SASI_Rn01_00115659 predicted 1054
8 SASI_Rn01_00115660 predicted 1143
9 SASI_Rn01_00115661 predicted 872
10 SASI_Rn01_00115662 predicted 1153
11 SASI_Rn01_00115663 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149470 predicted 527
2 SASI_Mm02_00326255 predicted 559
3 SASI_Mm01_00149471 predicted 1046
4 SASI_Mm02_00326256 predicted 365
5 SASI_Mm01_00149472 predicted 1641
6 SASI_Mm01_00149473 predicted 393
7 SASI_Mm01_00149474 predicted 1405
8 SASI_Mm01_00149475 predicted 1038
9 SASI_Mm01_00149477 predicted 995
10 SASI_Mm01_00149478 predicted 1372
11 SASI_Mm01_00149476 predicted 279
12 SASI_Mm01_00149479 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005746
NAMPT MISSION shRNA Bacterial Glycerol Stock
nicotinamide phosphoribosyltransferase
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000425996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005746.2-2018s21c1
Sequence:CCGGTAGTCATTCAATCTGGTATTGCTCGAGCAATACCAGATTGAATGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005746.2-1140s21c1
Sequence:CCGGAGCGATAGCTATGACATTTATCTCGAGATAAATGTCATAGCTATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005746.2-1183s21c1
Sequence:CCGGGTGAAGATCTAAGACATTTAACTCGAGTTAAATGTCTTAGATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005746
NAMPT MISSION shRNA shRNA Plasmid DNA
nicotinamide phosphoribosyltransferase
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000425996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005746.2-2018s21c1
Sequence:CCGGTAGTCATTCAATCTGGTATTGCTCGAGCAATACCAGATTGAATGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005746.2-1140s21c1
Sequence:CCGGAGCGATAGCTATGACATTTATCTCGAGATAAATGTCATAGCTATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005746.2-1183s21c1
Sequence:CCGGGTGAAGATCTAAGACATTTAACTCGAGTTAAATGTCTTAGATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005746
NAMPT MISSION shRNA Lentiviral Transduction Particles
nicotinamide phosphoribosyltransferase
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000425996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005746.2-2018s21c1
Sequence:CCGGTAGTCATTCAATCTGGTATTGCTCGAGCAATACCAGATTGAATGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005746.2-1140s21c1
Sequence:CCGGAGCGATAGCTATGACATTTATCTCGAGATAAATGTCATAGCTATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005746.2-1183s21c1
Sequence:CCGGGTGAAGATCTAAGACATTTAACTCGAGTTAAATGTCTTAGATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021524
VALIDATED
NAMPT MISSION shRNA Bacterial Glycerol Stock
nicotinamide phosphoribosyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-925s21c1
Sequence:CCGGTCAGCGATAGCTATGACATTTCTCGAGAAATGTCATAGCTATCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-147s21c1
Sequence:CCGGTACAAGGTTACTCACTATAAACTCGAGTTTATAGTGAGTAACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-553s21c1
Sequence:CCGGTTCAGTCCTGGTATCCAATTACTCGAGTAATTGGATACCAGGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021524.1-1667s21c1
Sequence:CCGGAGATGTGTGGGTTCGTGTTTACTCGAGTAAACACGAACCCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-1128s21c1
Sequence:CCGGCCACCTTATCTTAGAGTCATTCTCGAGAATGACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1700s1c1
Sequence:CCGGGCCAGATTATTTGTTGGTTTACTCGAGTAAACCAACAAATAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1246s1c1
Sequence:CCGGGCGCTTTGCTACAGAAGTTAACTCGAGTTAACTTCTGTAGCAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-199s1c1
Sequence:CCGGCCTACTTTGAATGCCGTGAAACTCGAGTTTCACGGCATTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1128s1c1
Sequence:CCGGCCACCTTATCTTAGAGTCATTCTCGAGAATGACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1127s1c1
Sequence:CCGGGCCACCTTATCTTAGAGTCATCTCGAGATGACTCTAAGATAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021524
VALIDATED
NAMPT MISSION shRNA shRNA Plasmid DNA
nicotinamide phosphoribosyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-925s21c1
Sequence:CCGGTCAGCGATAGCTATGACATTTCTCGAGAAATGTCATAGCTATCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-147s21c1
Sequence:CCGGTACAAGGTTACTCACTATAAACTCGAGTTTATAGTGAGTAACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-553s21c1
Sequence:CCGGTTCAGTCCTGGTATCCAATTACTCGAGTAATTGGATACCAGGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021524.1-1667s21c1
Sequence:CCGGAGATGTGTGGGTTCGTGTTTACTCGAGTAAACACGAACCCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-1128s21c1
Sequence:CCGGCCACCTTATCTTAGAGTCATTCTCGAGAATGACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1700s1c1
Sequence:CCGGGCCAGATTATTTGTTGGTTTACTCGAGTAAACCAACAAATAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1246s1c1
Sequence:CCGGGCGCTTTGCTACAGAAGTTAACTCGAGTTAACTTCTGTAGCAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-199s1c1
Sequence:CCGGCCTACTTTGAATGCCGTGAAACTCGAGTTTCACGGCATTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1128s1c1
Sequence:CCGGCCACCTTATCTTAGAGTCATTCTCGAGAATGACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1127s1c1
Sequence:CCGGGCCACCTTATCTTAGAGTCATCTCGAGATGACTCTAAGATAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021524
VALIDATED
NAMPT MISSION shRNA Lentiviral Transduction Particles
nicotinamide phosphoribosyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-925s21c1
Sequence:CCGGTCAGCGATAGCTATGACATTTCTCGAGAAATGTCATAGCTATCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-147s21c1
Sequence:CCGGTACAAGGTTACTCACTATAAACTCGAGTTTATAGTGAGTAACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-553s21c1
Sequence:CCGGTTCAGTCCTGGTATCCAATTACTCGAGTAATTGGATACCAGGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021524.1-1667s21c1
Sequence:CCGGAGATGTGTGGGTTCGTGTTTACTCGAGTAAACACGAACCCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021524.1-1128s21c1
Sequence:CCGGCCACCTTATCTTAGAGTCATTCTCGAGAATGACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1700s1c1
Sequence:CCGGGCCAGATTATTTGTTGGTTTACTCGAGTAAACCAACAAATAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1246s1c1
Sequence:CCGGGCGCTTTGCTACAGAAGTTAACTCGAGTTAACTTCTGTAGCAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-199s1c1
Sequence:CCGGCCTACTTTGAATGCCGTGAAACTCGAGTTTCACGGCATTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1128s1c1
Sequence:CCGGCCACCTTATCTTAGAGTCATTCTCGAGAATGACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021524.1-1127s1c1
Sequence:CCGGGCCACCTTATCTTAGAGTCATCTCGAGATGACTCTAAGATAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182790
VALIDATED
NAMPT MISSION shRNA Bacterial Glycerol Stock
nicotinamide phosphoribosyltransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-1070s1c1
Sequence:CCGGCCACCTTATCTTAGAGTTATTCTCGAGAATAACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182790.1-956s1c1
Sequence:CCGGCCACTAATAATCAGACCTGATCTCGAGATCAGGTCTGATTATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-579s1c1
Sequence:CCGGGTAACTTAGATGGTCTGGAATCTCGAGATTCCAGACCATCTAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182790.1-281s1c1
Sequence:CCGGGAAGCCAAAGATGTCTACAAACTCGAGTTTGTAGACATCTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-87s1c1
Sequence:CCGGCCTACAAGGTTACTCACTATACTCGAGTATAGTGAGTAACCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182790
VALIDATED
NAMPT MISSION shRNA shRNA Plasmid DNA
nicotinamide phosphoribosyltransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-1070s1c1
Sequence:CCGGCCACCTTATCTTAGAGTTATTCTCGAGAATAACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182790.1-956s1c1
Sequence:CCGGCCACTAATAATCAGACCTGATCTCGAGATCAGGTCTGATTATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-579s1c1
Sequence:CCGGGTAACTTAGATGGTCTGGAATCTCGAGATTCCAGACCATCTAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182790.1-281s1c1
Sequence:CCGGGAAGCCAAAGATGTCTACAAACTCGAGTTTGTAGACATCTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-87s1c1
Sequence:CCGGCCTACAAGGTTACTCACTATACTCGAGTATAGTGAGTAACCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182790
VALIDATED
NAMPT MISSION shRNA Lentiviral Transduction Particles
nicotinamide phosphoribosyltransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-1070s1c1
Sequence:CCGGCCACCTTATCTTAGAGTTATTCTCGAGAATAACTCTAAGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182790.1-956s1c1
Sequence:CCGGCCACTAATAATCAGACCTGATCTCGAGATCAGGTCTGATTATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-579s1c1
Sequence:CCGGGTAACTTAGATGGTCTGGAATCTCGAGATTCCAGACCATCTAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182790.1-281s1c1
Sequence:CCGGGAAGCCAAAGATGTCTACAAACTCGAGTTTGTAGACATCTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182790.1-87s1c1
Sequence:CCGGCCTACAAGGTTACTCACTATACTCGAGTATAGTGAGTAACCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks