EMAIL THIS PAGE TO A FRIEND

NARS2

asparaginyl-tRNA synthetase 2, mitochondrial (putative)

Synonyms: SLM5 asnRS
UniProtKB ID: Q96I59
Gene ID:
Mouse(244141) asparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Rat(293128) asparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Zebrafish(561673) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
chicken(419026) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
cow(504824) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Horse(100062849) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
domestic cat(101101161) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
dog(608831) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
sheep(101108871) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
naked mole-rat(101720888) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
domestic guinea pig(100735090) asparaginyl-tRNA synthetase 2, mitochondrial (putative)
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005271 MISSION® esiRNA esiRNA targeting human NARS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024678 Rosetta Predictions human pricing
NM_001034921 Rosetta Predictions rat pricing
NM_153591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137281 predicted 1303
2 SASI_Hs01_00137283 predicted 1292
3 SASI_Hs01_00137284 predicted 1667
4 SASI_Hs01_00137285 predicted 763
5 SASI_Hs02_00357109 predicted 384
6 SASI_Hs01_00137286 predicted 1260
7 SASI_Hs01_00137288 predicted 1450
8 SASI_Hs02_00357110 predicted 1305
9 SASI_Hs01_00137289 predicted 419
10 SASI_Hs02_00357111 predicted 1060
11 SASI_Hs01_00137282 predicted 1035
12 SASI_Hs01_00137287 predicted 1286
13 SASI_Hs01_00137290 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059955 predicted 1160
2 SASI_Rn01_00059956 predicted 872
3 SASI_Rn01_00059957 predicted 1409
4 SASI_Rn01_00059958 predicted 1499
5 SASI_Rn01_00059959 predicted 472
6 SASI_Rn01_00059960 predicted 1219
7 SASI_Rn01_00059961 predicted 724
8 SASI_Rn01_00059962 predicted 569
9 SASI_Rn01_00059963 predicted 940
10 SASI_Rn01_00059964 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078083 predicted 977
2 SASI_Mm01_00078084 predicted 1199
3 SASI_Mm01_00078085 predicted 502
4 SASI_Mm01_00078086 predicted 1751
5 SASI_Mm01_00078087 predicted 815
6 SASI_Mm01_00078088 predicted 1355
7 SASI_Mm01_00078089 predicted 488
8 SASI_Mm01_00078090 predicted 1244
9 SASI_Mm01_00078091 predicted 1528
10 SASI_Mm01_00078092 predicted 1608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024678
VALIDATED
NARS2 MISSION shRNA Bacterial Glycerol Stock
asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-1268s21c1
Sequence:CCGGACATACCTGTCTTCGTTATTACTCGAGTAATAACGAAGACAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024678.3-1817s21c1
Sequence:CCGGCCCGCAAGAAGAGGTACTTATCTCGAGATAAGTACCTCTTCTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-591s21c1
Sequence:CCGGTCTGGAGTACCTGCGACAATACTCGAGTATTGTCGCAGGTACTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-994s21c1
Sequence:CCGGCAAGATCTTATGCAGGTTATACTCGAGTATAACCTGCATAAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-632s21c1
Sequence:CCGGCTAACGTTCTGGGTTCTATATCTCGAGATATAGAACCCAGAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-1252s1c1
Sequence:CCGGGTGAAGCACTGTGGCAACATACTCGAGTATGTTGCCACAGTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1817s1c1
Sequence:CCGGCCCGCAAGAAGAGGTACTTATCTCGAGATAAGTACCTCTTCTTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-401s1c1
Sequence:CCGGGCCTTCAGGTTGTTGCAGATTCTCGAGAATCTGCAACAACCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-1579s1c1
Sequence:CCGGGTTATCCCTTTCCCAAGGTTTCTCGAGAAACCTTGGGAAAGGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-601s1c1
Sequence:CCGGCTGCGACAATATCCTCACTTTCTCGAGAAAGTGAGGATATTGTCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1265s1c1
Sequence:CCGGGCAACATACCTGTCTTCGTTACTCGAGTAACGAAGACAGGTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1655s1c1
Sequence:CCGGGCAGAGACACTGCACATGATTCTCGAGAATCATGTGCAGTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024678
VALIDATED
NARS2 MISSION shRNA shRNA Plasmid DNA
asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-1268s21c1
Sequence:CCGGACATACCTGTCTTCGTTATTACTCGAGTAATAACGAAGACAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024678.3-1817s21c1
Sequence:CCGGCCCGCAAGAAGAGGTACTTATCTCGAGATAAGTACCTCTTCTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-591s21c1
Sequence:CCGGTCTGGAGTACCTGCGACAATACTCGAGTATTGTCGCAGGTACTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-994s21c1
Sequence:CCGGCAAGATCTTATGCAGGTTATACTCGAGTATAACCTGCATAAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-632s21c1
Sequence:CCGGCTAACGTTCTGGGTTCTATATCTCGAGATATAGAACCCAGAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-1252s1c1
Sequence:CCGGGTGAAGCACTGTGGCAACATACTCGAGTATGTTGCCACAGTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1817s1c1
Sequence:CCGGCCCGCAAGAAGAGGTACTTATCTCGAGATAAGTACCTCTTCTTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-401s1c1
Sequence:CCGGGCCTTCAGGTTGTTGCAGATTCTCGAGAATCTGCAACAACCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-1579s1c1
Sequence:CCGGGTTATCCCTTTCCCAAGGTTTCTCGAGAAACCTTGGGAAAGGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-601s1c1
Sequence:CCGGCTGCGACAATATCCTCACTTTCTCGAGAAAGTGAGGATATTGTCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1265s1c1
Sequence:CCGGGCAACATACCTGTCTTCGTTACTCGAGTAACGAAGACAGGTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1655s1c1
Sequence:CCGGGCAGAGACACTGCACATGATTCTCGAGAATCATGTGCAGTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024678
VALIDATED
NARS2 MISSION shRNA Lentiviral Transduction Particles
asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-1268s21c1
Sequence:CCGGACATACCTGTCTTCGTTATTACTCGAGTAATAACGAAGACAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024678.3-1817s21c1
Sequence:CCGGCCCGCAAGAAGAGGTACTTATCTCGAGATAAGTACCTCTTCTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-591s21c1
Sequence:CCGGTCTGGAGTACCTGCGACAATACTCGAGTATTGTCGCAGGTACTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-994s21c1
Sequence:CCGGCAAGATCTTATGCAGGTTATACTCGAGTATAACCTGCATAAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024678.3-632s21c1
Sequence:CCGGCTAACGTTCTGGGTTCTATATCTCGAGATATAGAACCCAGAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-1252s1c1
Sequence:CCGGGTGAAGCACTGTGGCAACATACTCGAGTATGTTGCCACAGTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1817s1c1
Sequence:CCGGCCCGCAAGAAGAGGTACTTATCTCGAGATAAGTACCTCTTCTTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-401s1c1
Sequence:CCGGGCCTTCAGGTTGTTGCAGATTCTCGAGAATCTGCAACAACCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-1579s1c1
Sequence:CCGGGTTATCCCTTTCCCAAGGTTTCTCGAGAAACCTTGGGAAAGGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024678.3-601s1c1
Sequence:CCGGCTGCGACAATATCCTCACTTTCTCGAGAAAGTGAGGATATTGTCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1265s1c1
Sequence:CCGGGCAACATACCTGTCTTCGTTACTCGAGTAACGAAGACAGGTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024678.3-1655s1c1
Sequence:CCGGGCAGAGACACTGCACATGATTCTCGAGAATCATGTGCAGTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153591
VALIDATED
NARS2 MISSION shRNA Bacterial Glycerol Stock
asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-493s1c1
Sequence:CCGGGCCTTCAGATTGTTGCGGATTCTCGAGAATCCGCAACAATCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-768s1c1
Sequence:CCGGGCTGCTATTCATTCCTACTTTCTCGAGAAAGTAGGAATGAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-1629s1c1
Sequence:CCGGCGCTACTTACAGTGCATCCTACTCGAGTAGGATGCACTGTAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-1201s1c1
Sequence:CCGGGCAGACTAGAACATATGCTAACTCGAGTTAGCATATGTTCTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153591.2-2753s1c1
Sequence:CCGGCGCCTGTATTTGCGTGTGTATCTCGAGATACACACGCAAATACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153591
VALIDATED
NARS2 MISSION shRNA shRNA Plasmid DNA
asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-493s1c1
Sequence:CCGGGCCTTCAGATTGTTGCGGATTCTCGAGAATCCGCAACAATCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-768s1c1
Sequence:CCGGGCTGCTATTCATTCCTACTTTCTCGAGAAAGTAGGAATGAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-1629s1c1
Sequence:CCGGCGCTACTTACAGTGCATCCTACTCGAGTAGGATGCACTGTAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-1201s1c1
Sequence:CCGGGCAGACTAGAACATATGCTAACTCGAGTTAGCATATGTTCTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153591.2-2753s1c1
Sequence:CCGGCGCCTGTATTTGCGTGTGTATCTCGAGATACACACGCAAATACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153591
VALIDATED
NARS2 MISSION shRNA Lentiviral Transduction Particles
asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-493s1c1
Sequence:CCGGGCCTTCAGATTGTTGCGGATTCTCGAGAATCCGCAACAATCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-768s1c1
Sequence:CCGGGCTGCTATTCATTCCTACTTTCTCGAGAAAGTAGGAATGAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-1629s1c1
Sequence:CCGGCGCTACTTACAGTGCATCCTACTCGAGTAGGATGCACTGTAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153591.2-1201s1c1
Sequence:CCGGGCAGACTAGAACATATGCTAACTCGAGTTAGCATATGTTCTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153591.2-2753s1c1
Sequence:CCGGCGCCTGTATTTGCGTGTGTATCTCGAGATACACACGCAAATACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks