EMAIL THIS PAGE TO A FRIEND

NARS

asparaginyl-tRNA synthetase

Synonyms: ASNRS NARS1
UniProtKB ID: O43776, Q53GU6
Gene ID:
Human(4677) Summary: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. Asparaginyl-tRNA synthetase is localized to the cytoplasm and belongs to the class II family of tRNA synthetases. The N-terminal domain represents the signature sequence for the eukaryotic asparaginyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
Mouse(70223) asparaginyl-tRNA synthetase
Rat(291556) asparaginyl-tRNA synthetase
Zebrafish(568332) asparaginyl-tRNA synthetase
chicken(426856) asparaginyl-tRNA synthetase
domestic cat(101100757) asparaginyl-tRNA synthetase
cow(616033) asparaginyl-tRNA synthetase
dog(607631) asparaginyl-tRNA synthetase
naked mole-rat(101713992) asparaginyl-tRNA synthetase
sheep(678684) asparaginyl-tRNA synthetase
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004539 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004539 Rosetta Predictions human pricing
NM_001025635 Rosetta Predictions rat pricing
NM_027350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093348 predicted 756
2 SASI_Hs01_00093349 predicted 583
3 SASI_Hs01_00093350 predicted 512
4 SASI_Hs01_00093351 predicted 887
5 SASI_Hs01_00093353 predicted 758
6 SASI_Hs02_00337847 predicted 304
7 SASI_Hs01_00093354 predicted 1074
8 SASI_Hs01_00093355 predicted 1032
9 SASI_Hs01_00093356 predicted 559
10 SASI_Hs01_00093357 predicted 465
11 SASI_Hs01_00093352 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091767 predicted 1243
2 SASI_Rn01_00091768 predicted 1096
3 SASI_Rn01_00091769 predicted 1195
4 SASI_Rn01_00091770 predicted 1679
5 SASI_Rn01_00091771 predicted 1375
6 SASI_Rn01_00091772 predicted 657
7 SASI_Rn01_00091775 predicted 715
8 SASI_Rn02_00203204 predicted 1459
9 SASI_Rn02_00203205 predicted 1138
10 SASI_Rn02_00203206 predicted 1091
11 SASI_Rn01_00091773 predicted 1420
12 SASI_Rn01_00091774 predicted 1579
13 SASI_Rn01_00091776 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038733 predicted 1339
2 SASI_Mm01_00038734 predicted 1428
3 SASI_Mm01_00038735 predicted 1274
4 SASI_Mm01_00038737 predicted 753
5 SASI_Mm01_00038738 predicted 1508
6 SASI_Mm02_00332016 predicted 787
7 SASI_Mm01_00038739 predicted 1225
8 SASI_Mm01_00038740 predicted 1158
9 SASI_Mm01_00038741 predicted 1510
10 SASI_Mm02_00332017 predicted 836
11 SASI_Mm01_00038732 predicted 1568
12 SASI_Mm01_00038736 predicted 1488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027350
VALIDATED
NARS MISSION shRNA Bacterial Glycerol Stock
asparaginyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027350.1-2420s1c1
Sequence:CCGGGCAAAGACTTTGCACCTGAATCTCGAGATTCAGGTGCAAAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027350.1-1597s1c1
Sequence:CCGGCCGCTCCTTACTACTGGTATACTCGAGTATACCAGTAGTAAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027350.1-448s1c1
Sequence:CCGGCCTGTGTAAAGATTAGTGCATCTCGAGATGCACTAATCTTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027350.1-449s1c1
Sequence:CCGGCTGTGTAAAGATTAGTGCATTCTCGAGAATGCACTAATCTTTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027350.1-1335s1c1
Sequence:CCGGGACGGGACTTTCTACGAGTTTCTCGAGAAACTCGTAGAAAGTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1354s21c1
Sequence:CCGGGACGGGACTTTCTACGAGTTTCTCGAGAAACTCGTAGAAAGTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-2025s21c1
Sequence:CCGGTGCTATAGGTTACAATCATTGCTCGAGCAATGATTGTAACCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1253s21c1
Sequence:CCGGATGAGCTCAACCCGAACTTTACTCGAGTAAAGTTCGGGTTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1300s21c1
Sequence:CCGGATGAACTACTCGGATGCTATTCTCGAGAATAGCATCCGAGTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1579s21c1
Sequence:CCGGGAGATTCTCGAAGGCTATAAGCTCGAGCTTATAGCCTTCGAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027350
VALIDATED
NARS MISSION shRNA shRNA Plasmid DNA
asparaginyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027350.1-2420s1c1
Sequence:CCGGGCAAAGACTTTGCACCTGAATCTCGAGATTCAGGTGCAAAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027350.1-1597s1c1
Sequence:CCGGCCGCTCCTTACTACTGGTATACTCGAGTATACCAGTAGTAAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027350.1-448s1c1
Sequence:CCGGCCTGTGTAAAGATTAGTGCATCTCGAGATGCACTAATCTTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027350.1-449s1c1
Sequence:CCGGCTGTGTAAAGATTAGTGCATTCTCGAGAATGCACTAATCTTTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027350.1-1335s1c1
Sequence:CCGGGACGGGACTTTCTACGAGTTTCTCGAGAAACTCGTAGAAAGTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1354s21c1
Sequence:CCGGGACGGGACTTTCTACGAGTTTCTCGAGAAACTCGTAGAAAGTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-2025s21c1
Sequence:CCGGTGCTATAGGTTACAATCATTGCTCGAGCAATGATTGTAACCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1253s21c1
Sequence:CCGGATGAGCTCAACCCGAACTTTACTCGAGTAAAGTTCGGGTTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1300s21c1
Sequence:CCGGATGAACTACTCGGATGCTATTCTCGAGAATAGCATCCGAGTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1579s21c1
Sequence:CCGGGAGATTCTCGAAGGCTATAAGCTCGAGCTTATAGCCTTCGAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027350
VALIDATED
NARS MISSION shRNA Lentiviral Transduction Particles
asparaginyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027350.1-2420s1c1
Sequence:CCGGGCAAAGACTTTGCACCTGAATCTCGAGATTCAGGTGCAAAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027350.1-1597s1c1
Sequence:CCGGCCGCTCCTTACTACTGGTATACTCGAGTATACCAGTAGTAAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027350.1-448s1c1
Sequence:CCGGCCTGTGTAAAGATTAGTGCATCTCGAGATGCACTAATCTTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027350.1-449s1c1
Sequence:CCGGCTGTGTAAAGATTAGTGCATTCTCGAGAATGCACTAATCTTTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027350.1-1335s1c1
Sequence:CCGGGACGGGACTTTCTACGAGTTTCTCGAGAAACTCGTAGAAAGTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1354s21c1
Sequence:CCGGGACGGGACTTTCTACGAGTTTCTCGAGAAACTCGTAGAAAGTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-2025s21c1
Sequence:CCGGTGCTATAGGTTACAATCATTGCTCGAGCAATGATTGTAACCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1253s21c1
Sequence:CCGGATGAGCTCAACCCGAACTTTACTCGAGTAAAGTTCGGGTTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1300s21c1
Sequence:CCGGATGAACTACTCGGATGCTATTCTCGAGAATAGCATCCGAGTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027350.3-1579s21c1
Sequence:CCGGGAGATTCTCGAAGGCTATAAGCTCGAGCTTATAGCCTTCGAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004539
VALIDATED
NARS MISSION shRNA Bacterial Glycerol Stock
asparaginyl-tRNA synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004539.2-1560s1c1
Sequence:CCGGCCACTCCCTATTACTGGTATACTCGAGTATACCAGTAATAGGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-1231s1c1
Sequence:CCGGGCCTTTCAAACGGATGAACTACTCGAGTAGTTCATCCGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-611s1c1
Sequence:CCGGGCAGTGTATGGAATGCTAAATCTCGAGATTTAGCATTCCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-362s1c1
Sequence:CCGGGAAGCAAAGAAGATTACCATTCTCGAGAATGGTAATCTTCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-1679s1c1
Sequence:CCGGGTGTGCTTATACCCTCGATTTCTCGAGAAATCGAGGGTATAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-517s21c1
Sequence:CCGGGAAGCAAAGAAGATTACCATTCTCGAGAATGGTAATCTTCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-766s21c1
Sequence:CCGGGCAGTGTATGGAATGCTAAATCTCGAGATTTAGCATTCCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-1834s21c1
Sequence:CCGGGTGTGCTTATACCCTCGATTTCTCGAGAAATCGAGGGTATAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-1386s21c1
Sequence:CCGGGCCTTTCAAACGGATGAACTACTCGAGTAGTTCATCCGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004539
VALIDATED
NARS MISSION shRNA shRNA Plasmid DNA
asparaginyl-tRNA synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004539.2-1560s1c1
Sequence:CCGGCCACTCCCTATTACTGGTATACTCGAGTATACCAGTAATAGGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-1231s1c1
Sequence:CCGGGCCTTTCAAACGGATGAACTACTCGAGTAGTTCATCCGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-611s1c1
Sequence:CCGGGCAGTGTATGGAATGCTAAATCTCGAGATTTAGCATTCCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-362s1c1
Sequence:CCGGGAAGCAAAGAAGATTACCATTCTCGAGAATGGTAATCTTCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-1679s1c1
Sequence:CCGGGTGTGCTTATACCCTCGATTTCTCGAGAAATCGAGGGTATAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-517s21c1
Sequence:CCGGGAAGCAAAGAAGATTACCATTCTCGAGAATGGTAATCTTCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-766s21c1
Sequence:CCGGGCAGTGTATGGAATGCTAAATCTCGAGATTTAGCATTCCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-1834s21c1
Sequence:CCGGGTGTGCTTATACCCTCGATTTCTCGAGAAATCGAGGGTATAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-1386s21c1
Sequence:CCGGGCCTTTCAAACGGATGAACTACTCGAGTAGTTCATCCGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004539
VALIDATED
NARS MISSION shRNA Lentiviral Transduction Particles
asparaginyl-tRNA synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004539.2-1560s1c1
Sequence:CCGGCCACTCCCTATTACTGGTATACTCGAGTATACCAGTAATAGGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-1231s1c1
Sequence:CCGGGCCTTTCAAACGGATGAACTACTCGAGTAGTTCATCCGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-611s1c1
Sequence:CCGGGCAGTGTATGGAATGCTAAATCTCGAGATTTAGCATTCCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-362s1c1
Sequence:CCGGGAAGCAAAGAAGATTACCATTCTCGAGAATGGTAATCTTCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004539.2-1679s1c1
Sequence:CCGGGTGTGCTTATACCCTCGATTTCTCGAGAAATCGAGGGTATAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-517s21c1
Sequence:CCGGGAAGCAAAGAAGATTACCATTCTCGAGAATGGTAATCTTCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-766s21c1
Sequence:CCGGGCAGTGTATGGAATGCTAAATCTCGAGATTTAGCATTCCATACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-1834s21c1
Sequence:CCGGGTGTGCTTATACCCTCGATTTCTCGAGAAATCGAGGGTATAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004539.3-1386s21c1
Sequence:CCGGGCCTTTCAAACGGATGAACTACTCGAGTAGTTCATCCGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks