EMAIL THIS PAGE TO A FRIEND

NAT14

N-acetyltransferase 14 (GCN5-related, putative)

Synonyms: KLP1
UniProtKB ID: Q8WUY8, Q8TDY7, Q9NS72
Gene ID:
Mouse(269854) N-acetyltransferase 14
Rat(361500) N-acetyltransferase 14
domestic cat(101083889) N-acetyltransferase 14 (GCN5-related, putative)
cow(532809) N-acetyltransferase 14 (GCN5-related, putative)
dog(611287) N-acetyltransferase 14 (GCN5-related, putative)
naked mole-rat(101702170) N-acetyltransferase 14 (GCN5-related, putative)
domestic guinea pig(100713346) N-acetyltransferase 14 (GCN5-related, putative)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020378 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020378 Rosetta Predictions human pricing
NM_001108466 Rosetta Predictions rat pricing
NM_201355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085971 predicted 687
2 SASI_Hs02_00353337 predicted 244
3 SASI_Hs02_00353338 predicted 1094
4 SASI_Hs02_00353339 predicted 938
5 SASI_Hs02_00353340 predicted 683
6 SASI_Hs01_00085966 predicted 655
7 SASI_Hs01_00085967 predicted 1003
8 SASI_Hs01_00085968 predicted 881
9 SASI_Hs01_00085969 predicted 756
10 SASI_Hs02_00353341 predicted 748
11 SASI_Hs01_00085970 predicted 1064
12 SASI_Hs01_00085972 predicted 790
13 SASI_Hs01_00085973 predicted 874
14 SASI_Hs01_00085974 predicted 982
15 SASI_Hs01_00085975 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238919 predicted 996
2 SASI_Rn02_00238920 predicted 727
3 SASI_Rn02_00238921 predicted 1015
4 SASI_Rn02_00238922 predicted 946
5 SASI_Rn02_00238923 predicted 976
6 SASI_Rn02_00238924 predicted 952
7 SASI_Rn02_00238925 predicted 964
8 SASI_Rn02_00238926 predicted 788
9 SASI_Rn02_00238927 predicted 377
10 SASI_Rn02_00238928 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123262 predicted 1179
2 SASI_Mm02_00351508 predicted 1086
3 SASI_Mm02_00351509 predicted 1018
4 SASI_Mm01_00123263 predicted 1035
5 SASI_Mm01_00123264 predicted 1013
6 SASI_Mm01_00123267 predicted 1150
7 SASI_Mm02_00351510 predicted 495
8 SASI_Mm01_00123269 predicted 1019
9 SASI_Mm02_00351511 predicted 1147
10 SASI_Mm02_00351512 predicted 886
11 SASI_Mm01_00123265 predicted 824
12 SASI_Mm01_00123266 predicted 448
13 SASI_Mm01_00123268 predicted 457
14 SASI_Mm01_00123270 predicted 703
15 SASI_Mm01_00123271 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201355
NAT14 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 14 (GCN5-related, putative)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-1040s21c1
Sequence:CCGGTTCAGCAAAGACCTGTGATTACTCGAGTAATCACAGGTCTTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-499s21c1
Sequence:CCGGGATGCTGAAGGCTGGTGTAAACTCGAGTTTACACCAGCCTTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-649s21c1
Sequence:CCGGTCTGGCTGTAGCCGCTGTGAACTCGAGTTCACAGCGGCTACAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-1016s21c1
Sequence:CCGGATGGGCTATATGCTGGTTAGGCTCGAGCCTAACCAGCATATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201355.3-1219s21c1
Sequence:CCGGAGCTGCAATGAGGACTCTAAACTCGAGTTTAGAGTCCTCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201355.2-819s1c1
Sequence:CCGGCGAGGTTGATGGACTTACATTCTCGAGAATGTAAGTCCATCAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201355.2-135s1c1
Sequence:CCGGGATGCTGAAGGCTGGTGTAAACTCGAGTTTACACCAGCCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201355.2-656s1c1
Sequence:CCGGGCTATATGCTGGTTAGGGAATCTCGAGATTCCCTAACCAGCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201355
NAT14 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 14 (GCN5-related, putative)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-1040s21c1
Sequence:CCGGTTCAGCAAAGACCTGTGATTACTCGAGTAATCACAGGTCTTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-499s21c1
Sequence:CCGGGATGCTGAAGGCTGGTGTAAACTCGAGTTTACACCAGCCTTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-649s21c1
Sequence:CCGGTCTGGCTGTAGCCGCTGTGAACTCGAGTTCACAGCGGCTACAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-1016s21c1
Sequence:CCGGATGGGCTATATGCTGGTTAGGCTCGAGCCTAACCAGCATATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201355.3-1219s21c1
Sequence:CCGGAGCTGCAATGAGGACTCTAAACTCGAGTTTAGAGTCCTCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201355.2-819s1c1
Sequence:CCGGCGAGGTTGATGGACTTACATTCTCGAGAATGTAAGTCCATCAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201355.2-135s1c1
Sequence:CCGGGATGCTGAAGGCTGGTGTAAACTCGAGTTTACACCAGCCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201355.2-656s1c1
Sequence:CCGGGCTATATGCTGGTTAGGGAATCTCGAGATTCCCTAACCAGCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201355
NAT14 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 14 (GCN5-related, putative)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-1040s21c1
Sequence:CCGGTTCAGCAAAGACCTGTGATTACTCGAGTAATCACAGGTCTTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-499s21c1
Sequence:CCGGGATGCTGAAGGCTGGTGTAAACTCGAGTTTACACCAGCCTTCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-649s21c1
Sequence:CCGGTCTGGCTGTAGCCGCTGTGAACTCGAGTTCACAGCGGCTACAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201355.3-1016s21c1
Sequence:CCGGATGGGCTATATGCTGGTTAGGCTCGAGCCTAACCAGCATATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201355.3-1219s21c1
Sequence:CCGGAGCTGCAATGAGGACTCTAAACTCGAGTTTAGAGTCCTCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201355.2-819s1c1
Sequence:CCGGCGAGGTTGATGGACTTACATTCTCGAGAATGTAAGTCCATCAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201355.2-135s1c1
Sequence:CCGGGATGCTGAAGGCTGGTGTAAACTCGAGTTTACACCAGCCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201355.2-656s1c1
Sequence:CCGGGCTATATGCTGGTTAGGGAATCTCGAGATTCCCTAACCAGCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020378
NAT14 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 14 (GCN5-related, putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020378.2-876s21c1
Sequence:CCGGGTGTGAAGTCTGTAGTGTTTGCTCGAGCAAACACTACAGACTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-699s21c1
Sequence:CCGGTGAAGCTACAGACTGACAGCCCTCGAGGGCTGTCAGTCTGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-688s21c1
Sequence:CCGGGCAAAGACCTGTGAAGCTACACTCGAGTGTAGCTTCACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-107s21c1
Sequence:CCGGGGAGATGAGGGAAGATGAGAACTCGAGTTCTCATCTTCCCTCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-664s21c1
Sequence:CCGGGCTACACGCTGGTGAGGGAATCTCGAGATTCCCTCACCAGCGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020378
NAT14 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 14 (GCN5-related, putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020378.2-876s21c1
Sequence:CCGGGTGTGAAGTCTGTAGTGTTTGCTCGAGCAAACACTACAGACTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-699s21c1
Sequence:CCGGTGAAGCTACAGACTGACAGCCCTCGAGGGCTGTCAGTCTGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-688s21c1
Sequence:CCGGGCAAAGACCTGTGAAGCTACACTCGAGTGTAGCTTCACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-107s21c1
Sequence:CCGGGGAGATGAGGGAAGATGAGAACTCGAGTTCTCATCTTCCCTCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-664s21c1
Sequence:CCGGGCTACACGCTGGTGAGGGAATCTCGAGATTCCCTCACCAGCGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020378
NAT14 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 14 (GCN5-related, putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020378.2-876s21c1
Sequence:CCGGGTGTGAAGTCTGTAGTGTTTGCTCGAGCAAACACTACAGACTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-699s21c1
Sequence:CCGGTGAAGCTACAGACTGACAGCCCTCGAGGGCTGTCAGTCTGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-688s21c1
Sequence:CCGGGCAAAGACCTGTGAAGCTACACTCGAGTGTAGCTTCACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-107s21c1
Sequence:CCGGGGAGATGAGGGAAGATGAGAACTCGAGTTCTCATCTTCCCTCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020378.2-664s21c1
Sequence:CCGGGCTACACGCTGGTGAGGGAATCTCGAGATTCCCTCACCAGCGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks