EMAIL THIS PAGE TO A FRIEND

NBL1

neuroblastoma 1, DAN family BMP antagonist

Synonyms: D1S1733E DAN DAND1 NB NO3
UniProtKB ID: P41271, A3KFI7, Q5TGZ2, Q5U0N4, Q96L68
Gene ID:
Human(4681) Summary: This gene product is the founding member of the evolutionarily conserved CAN (Cerberus and DAN) family of proteins, which contain a domain resembling the CTCK (C-terminal cystine knot-like) motif found in a number of signaling molecules. These proteins are secreted, and act as BMP (bone morphogenetic protein) antagonists by binding to BMPs and preventing them from interacting with their receptors. They may thus play an important role during growth and development. Alternatively spliced transcript variants have been identified for this gene. Read-through transcripts between this locus and the upstream mitochondrial inner membrane organizing system 1 gene (GeneID 440574) have been observed. [provided by RefSeq, May 2013]
Mouse(17965) neuroblastoma, suppression of tumorigenicity 1
Rat(50594) neuroblastoma 1, DAN family BMP antagonist
Zebrafish(404629) neuroblastoma, suppression of tumorigenicity 1
cow(535280) neuroblastoma 1, DAN family BMP antagonist
Horse(100071893) neuroblastoma, suppression of tumorigenicity 1
dog(487403) neuroblastoma, suppression of tumorigenicity 1
domestic cat(101090533) neuroblastoma, suppression of tumorigenicity 1
chicken(373952) neuroblastoma, suppression of tumorigenicity 1
sheep(101108197) neuroblastoma, suppression of tumorigenicity 1
domestic guinea pig(100732484) neuroblastoma 1, DAN family BMP antagonist
naked mole-rat(101708204) neuroblastoma 1, DAN family BMP antagonist
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005380 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005380 Rosetta Predictions human pricing
NM_182744 Rosetta Predictions human pricing
NM_031609 Rosetta Predictions rat pricing
NM_008675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124987 predicted 541
2 SASI_Hs01_00124988 predicted 868
3 SASI_Hs01_00124989 predicted 220
4 SASI_Hs01_00124990 predicted 1087
5 SASI_Hs01_00124991 predicted 805
6 SASI_Hs01_00124992 predicted 482
7 SASI_Hs01_00124993 predicted 1023
8 SASI_Hs01_00124994 predicted 1133
9 SASI_Hs01_00124995 predicted 991
10 SASI_Hs02_00339490 predicted 385
11 SASI_Hs01_00124986 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141917 predicted 251
2 SASI_Hs02_00370892 predicted 990
3 SASI_Hs02_00370893 predicted 1103
4 SASI_Hs02_00370894 predicted 907
5 SASI_Hs01_00141920 predicted 512
6 SASI_Hs01_00141921 predicted 1055
7 SASI_Hs01_00141922 predicted 1173
8 SASI_Hs01_00141923 predicted 1023
9 SASI_Hs02_00370895 predicted 415
10 SASI_Hs02_00370896 predicted 353
11 SASI_Hs01_00141914 predicted 404
12 SASI_Hs01_00141915 predicted 584
13 SASI_Hs01_00141916 predicted 908
14 SASI_Hs01_00141918 predicted 1128
15 SASI_Hs01_00141919 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088379 predicted 359
2 SASI_Rn01_00088380 predicted 824
3 SASI_Rn01_00088381 predicted 902
4 SASI_Rn01_00088382 predicted 566
5 SASI_Rn01_00088383 predicted 458
6 SASI_Rn01_00088384 predicted 325
7 SASI_Rn01_00088385 predicted 966
8 SASI_Rn01_00088386 predicted 584
9 SASI_Rn01_00088387 predicted 554
10 SASI_Rn01_00088388 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035286 predicted 903
2 SASI_Mm01_00035279 predicted 1162
3 SASI_Mm01_00035283 predicted 437
4 SASI_Mm01_00035287 predicted 947
5 SASI_Mm01_00035280 predicted 310
6 SASI_Mm01_00035282 predicted 515
7 SASI_Mm02_00314446 predicted 877
8 SASI_Mm01_00035284 predicted 545
9 SASI_Mm02_00314447 predicted 875
10 SASI_Mm01_00035285 predicted 1121
11 SASI_Mm01_00035278 predicted 460
12 SASI_Mm01_00035281 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008675
NBL1 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma 1, DAN family BMP antagonist
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-1132s21c1
Sequence:CCGGCTTTGCTGAAGGACCTATGTGCTCGAGCACATAGGTCCTTCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-941s21c1
Sequence:CCGGGAAGGTGAAGTGTGGTCTTTCCTCGAGGAAAGACCACACTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008675.2-568s21c1
Sequence:CCGGCGTCTATGTGCAGGGTGAAGACTCGAGTCTTCACCCTGCACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-1177s21c1
Sequence:CCGGAGCTCCAGTCCCATAGGTTTCCTCGAGGAAACCTATGGGACTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008675.1-767s1c1
Sequence:CCGGGCCAAGCTGCACAATTTAATACTCGAGTATTAAATTGTGCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-326s1c1
Sequence:CCGGGCCCAGTCCATGTGGGAGATTCTCGAGAATCTCCCACATGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-211s1c1
Sequence:CCGGTGAGGCCAAGTCTATCCAGAACTCGAGTTCTGGATAGACTTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-173s1c1
Sequence:CCGGGCCAAGAACATCACGCAGATTCTCGAGAATCTGCGTGATGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-241s1c1
Sequence:CCGGCCTAGGACAATGCTTCAGTTACTCGAGTAACTGAAGCATTGTCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008675
NBL1 MISSION shRNA shRNA Plasmid DNA
neuroblastoma 1, DAN family BMP antagonist
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-1132s21c1
Sequence:CCGGCTTTGCTGAAGGACCTATGTGCTCGAGCACATAGGTCCTTCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-941s21c1
Sequence:CCGGGAAGGTGAAGTGTGGTCTTTCCTCGAGGAAAGACCACACTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008675.2-568s21c1
Sequence:CCGGCGTCTATGTGCAGGGTGAAGACTCGAGTCTTCACCCTGCACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-1177s21c1
Sequence:CCGGAGCTCCAGTCCCATAGGTTTCCTCGAGGAAACCTATGGGACTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008675.1-767s1c1
Sequence:CCGGGCCAAGCTGCACAATTTAATACTCGAGTATTAAATTGTGCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-326s1c1
Sequence:CCGGGCCCAGTCCATGTGGGAGATTCTCGAGAATCTCCCACATGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-211s1c1
Sequence:CCGGTGAGGCCAAGTCTATCCAGAACTCGAGTTCTGGATAGACTTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-173s1c1
Sequence:CCGGGCCAAGAACATCACGCAGATTCTCGAGAATCTGCGTGATGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-241s1c1
Sequence:CCGGCCTAGGACAATGCTTCAGTTACTCGAGTAACTGAAGCATTGTCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008675
NBL1 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma 1, DAN family BMP antagonist
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-1132s21c1
Sequence:CCGGCTTTGCTGAAGGACCTATGTGCTCGAGCACATAGGTCCTTCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-941s21c1
Sequence:CCGGGAAGGTGAAGTGTGGTCTTTCCTCGAGGAAAGACCACACTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008675.2-568s21c1
Sequence:CCGGCGTCTATGTGCAGGGTGAAGACTCGAGTCTTCACCCTGCACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008675.2-1177s21c1
Sequence:CCGGAGCTCCAGTCCCATAGGTTTCCTCGAGGAAACCTATGGGACTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008675.1-767s1c1
Sequence:CCGGGCCAAGCTGCACAATTTAATACTCGAGTATTAAATTGTGCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-326s1c1
Sequence:CCGGGCCCAGTCCATGTGGGAGATTCTCGAGAATCTCCCACATGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-211s1c1
Sequence:CCGGTGAGGCCAAGTCTATCCAGAACTCGAGTTCTGGATAGACTTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-173s1c1
Sequence:CCGGGCCAAGAACATCACGCAGATTCTCGAGAATCTGCGTGATGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008675.1-241s1c1
Sequence:CCGGCCTAGGACAATGCTTCAGTTACTCGAGTAACTGAAGCATTGTCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005380
NBL1 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma 1, DAN family BMP antagonist
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005380.4-1144s21c1
Sequence:CCGGAGAAAGACCACTGGCAGAAACCTCGAGGTTTCTGCCAGTGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005380.4-1029s21c1
Sequence:CCGGCCATCCAAGATGGCATGAATCCTCGAGGATTCATGCCATCTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-292s1c1
Sequence:CCGGTGAGGCCAAGTCCATCCAGAACTCGAGTTCTGGATGGACTTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-479s1c1
Sequence:CCGGGTGGAGAAGATCCTGCACTGTCTCGAGACAGTGCAGGATCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-217s1c1
Sequence:CCGGGCTGGCACTGTTCCCAGATAACTCGAGTTATCTGGGAACAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005380
NBL1 MISSION shRNA shRNA Plasmid DNA
neuroblastoma 1, DAN family BMP antagonist
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005380.4-1144s21c1
Sequence:CCGGAGAAAGACCACTGGCAGAAACCTCGAGGTTTCTGCCAGTGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005380.4-1029s21c1
Sequence:CCGGCCATCCAAGATGGCATGAATCCTCGAGGATTCATGCCATCTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-292s1c1
Sequence:CCGGTGAGGCCAAGTCCATCCAGAACTCGAGTTCTGGATGGACTTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-479s1c1
Sequence:CCGGGTGGAGAAGATCCTGCACTGTCTCGAGACAGTGCAGGATCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-217s1c1
Sequence:CCGGGCTGGCACTGTTCCCAGATAACTCGAGTTATCTGGGAACAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005380
NBL1 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma 1, DAN family BMP antagonist
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005380.4-1144s21c1
Sequence:CCGGAGAAAGACCACTGGCAGAAACCTCGAGGTTTCTGCCAGTGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005380.4-1029s21c1
Sequence:CCGGCCATCCAAGATGGCATGAATCCTCGAGGATTCATGCCATCTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-292s1c1
Sequence:CCGGTGAGGCCAAGTCCATCCAGAACTCGAGTTCTGGATGGACTTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-479s1c1
Sequence:CCGGGTGGAGAAGATCCTGCACTGTCTCGAGACAGTGCAGGATCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005380.3-217s1c1
Sequence:CCGGGCTGGCACTGTTCCCAGATAACTCGAGTTATCTGGGAACAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks