EMAIL THIS PAGE TO A FRIEND

NCAPD3

non-SMC condensin II complex, subunit D3

Synonyms: CAP-D3 CAPD3 hCAP-D3 hHCP-6 hcp-6
UniProtKB ID: P42695, A6NFS2, Q4KMQ9
Gene ID:
Human(23310) Summary: Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]
Mouse(78658) non-SMC condensin II complex, subunit D3
Rat(315508) non-SMC condensin II complex, subunit D3
Zebrafish(556493) non-SMC condensin II complex, subunit D3
chicken(419737) non-SMC condensin II complex, subunit D3
domestic cat(101097274) non-SMC condensin II complex, subunit D3
cow(511958) non-SMC condensin II complex, subunit D3
Horse(100072875) non-SMC condensin II complex, subunit D3
dog(489270) non-SMC condensin II complex, subunit D3
domestic guinea pig(100735201) non-SMC condensin II complex, subunit D3
naked mole-rat(101707670) non-SMC condensin II complex, subunit D3
sheep(101115229) non-SMC condensin II complex, subunit D3
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015261 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015261 Rosetta Predictions human pricing
NM_001034000 Rosetta Predictions rat pricing
NM_178113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082609 predicted 1094
2 SASI_Hs01_00082610 predicted 913
3 SASI_Hs02_00347410 predicted 1163
4 SASI_Hs01_00082611 predicted 3919
5 SASI_Hs01_00082612 predicted 818
6 SASI_Hs01_00082613 predicted 2061
7 SASI_Hs01_00082614 predicted 1227
8 SASI_Hs01_00082615 predicted 3054
9 SASI_Hs02_00347411 predicted 2186
10 SASI_Hs01_00082617 predicted 2031
11 SASI_Hs01_00082616 predicted 1603
12 SASI_Hs01_00082618 predicted 1947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033112 predicted 1019
2 SASI_Rn01_00033113 predicted 1147
3 SASI_Rn01_00033114 predicted 377
4 SASI_Rn01_00033115 predicted 4249
5 SASI_Rn01_00033116 predicted 1708
6 SASI_Rn01_00033118 predicted 2203
7 SASI_Rn01_00033119 predicted 2428
8 SASI_Rn01_00033120 predicted 3487
9 SASI_Rn02_00203875 predicted 3043
10 SASI_Rn01_00033121 predicted 4151
11 SASI_Rn01_00033117 predicted 3505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130663 predicted 1879
2 SASI_Mm02_00348579 predicted 3912
3 SASI_Mm01_00130665 predicted 4012
4 SASI_Mm01_00130666 predicted 1527
5 SASI_Mm02_00348580 predicted 2222
6 SASI_Mm02_00348581 predicted 3468
7 SASI_Mm01_00130667 predicted 1176
8 SASI_Mm01_00130668 predicted 1439
9 SASI_Mm01_00130669 predicted 3078
10 SASI_Mm01_00130670 predicted 2255
11 SASI_Mm01_00130661 predicted 974
12 SASI_Mm01_00130662 predicted 1965
13 SASI_Mm01_00130664 predicted 2722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178113
VALIDATED
NCAPD3 MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin II complex, subunit D3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-4894s21c1
Sequence:CCGGGTCTCCACAGTGGAACGTAAACTCGAGTTTACGTTCCACTGTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178113.3-5241s21c1
Sequence:CCGGTATACTGTGATACTCTATTTGCTCGAGCAAATAGAGTATCACAGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-4754s21c1
Sequence:CCGGTCCATCAGTGACGTCACATTTCTCGAGAAATGTGACGTCACTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-1092s21c1
Sequence:CCGGGCCGGGACCTTTGTCAAATACCTCGAGGTATTTGACAAAGGTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178113.3-5213s1c1
Sequence:CCGGGACTTTCTCACAATAACATTACTCGAGTAATGTTATTGTGAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178113.2-1647s1c1
Sequence:CCGGCCACATTCATTGCCTGGCTTTCTCGAGAAAGCCAGGCAATGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178113.2-4501s1c1
Sequence:CCGGGCTTTCTTCTGTATAACTCAACTCGAGTTGAGTTATACAGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178113.2-3880s1c1
Sequence:CCGGGCTCTCAGATACCTTTGACATCTCGAGATGTCAAAGGTATCTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178113.2-881s1c1
Sequence:CCGGGTGATGTTTGACAAGTGTATTCTCGAGAATACACTTGTCAAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-2731s1c1
Sequence:CCGGGCTGTGTGTCATTGGGCATATCTCGAGATATGCCCAATGACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-3465s1c1
Sequence:CCGGCCAACCTCTTACAGGAGGAATCTCGAGATTCCTCCTGTAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-2401s1c1
Sequence:CCGGGCAGAACATTAAGCATCACAACTCGAGTTGTGATGCTTAATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178113
VALIDATED
NCAPD3 MISSION shRNA shRNA Plasmid DNA
non-SMC condensin II complex, subunit D3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-4894s21c1
Sequence:CCGGGTCTCCACAGTGGAACGTAAACTCGAGTTTACGTTCCACTGTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178113.3-5241s21c1
Sequence:CCGGTATACTGTGATACTCTATTTGCTCGAGCAAATAGAGTATCACAGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-4754s21c1
Sequence:CCGGTCCATCAGTGACGTCACATTTCTCGAGAAATGTGACGTCACTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-1092s21c1
Sequence:CCGGGCCGGGACCTTTGTCAAATACCTCGAGGTATTTGACAAAGGTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178113.3-5213s1c1
Sequence:CCGGGACTTTCTCACAATAACATTACTCGAGTAATGTTATTGTGAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178113.2-1647s1c1
Sequence:CCGGCCACATTCATTGCCTGGCTTTCTCGAGAAAGCCAGGCAATGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178113.2-4501s1c1
Sequence:CCGGGCTTTCTTCTGTATAACTCAACTCGAGTTGAGTTATACAGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178113.2-3880s1c1
Sequence:CCGGGCTCTCAGATACCTTTGACATCTCGAGATGTCAAAGGTATCTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178113.2-881s1c1
Sequence:CCGGGTGATGTTTGACAAGTGTATTCTCGAGAATACACTTGTCAAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-2731s1c1
Sequence:CCGGGCTGTGTGTCATTGGGCATATCTCGAGATATGCCCAATGACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-3465s1c1
Sequence:CCGGCCAACCTCTTACAGGAGGAATCTCGAGATTCCTCCTGTAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-2401s1c1
Sequence:CCGGGCAGAACATTAAGCATCACAACTCGAGTTGTGATGCTTAATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178113
VALIDATED
NCAPD3 MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin II complex, subunit D3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-4894s21c1
Sequence:CCGGGTCTCCACAGTGGAACGTAAACTCGAGTTTACGTTCCACTGTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178113.3-5241s21c1
Sequence:CCGGTATACTGTGATACTCTATTTGCTCGAGCAAATAGAGTATCACAGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-4754s21c1
Sequence:CCGGTCCATCAGTGACGTCACATTTCTCGAGAAATGTGACGTCACTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178113.3-1092s21c1
Sequence:CCGGGCCGGGACCTTTGTCAAATACCTCGAGGTATTTGACAAAGGTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178113.3-5213s1c1
Sequence:CCGGGACTTTCTCACAATAACATTACTCGAGTAATGTTATTGTGAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178113.2-1647s1c1
Sequence:CCGGCCACATTCATTGCCTGGCTTTCTCGAGAAAGCCAGGCAATGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178113.2-4501s1c1
Sequence:CCGGGCTTTCTTCTGTATAACTCAACTCGAGTTGAGTTATACAGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178113.2-3880s1c1
Sequence:CCGGGCTCTCAGATACCTTTGACATCTCGAGATGTCAAAGGTATCTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178113.2-881s1c1
Sequence:CCGGGTGATGTTTGACAAGTGTATTCTCGAGAATACACTTGTCAAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-2731s1c1
Sequence:CCGGGCTGTGTGTCATTGGGCATATCTCGAGATATGCCCAATGACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-3465s1c1
Sequence:CCGGCCAACCTCTTACAGGAGGAATCTCGAGATTCCTCCTGTAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178113.2-2401s1c1
Sequence:CCGGGCAGAACATTAAGCATCACAACTCGAGTTGTGATGCTTAATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015261
VALIDATED
NCAPD3 MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin II complex, subunit D3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-1622s21c1
Sequence:GTACCGGGCGCCCTTGTGGATGAATTAACTCGAGTTAATTCATCCACAAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-4050s21c1
Sequence:CCGGCCTCAGCTCAAAGGAGATCAACTCGAGTTGATCTCCTTTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-3352s21c1
Sequence:CCGGCCCTCTGTGATTAGAGCACATCTCGAGATGTGCTCTAATCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-1858s21c1
Sequence:CCGGGCTCTGTTAGAACTGCCTGAACTCGAGTTCAGGCAGTTCTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-3476s21c1
Sequence:CCGGTCCGCAACAACGTCATCATTGCTCGAGCAATGATGACGTTGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-5377s21c1
Sequence:CCGGCCCATTCAGATAAGCTATAATCTCGAGATTATAGCTTATCTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-75s1c1
Sequence:CCGGCGCTGGATCTTAGACTCGAATCTCGAGATTCGAGTCTAAGATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-3472s1c1
Sequence:CCGGCCTCAGCTCAAAGGAGATCAACTCGAGTTGATCTCCTTTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-1486s1c1
Sequence:CCGGCCTGATTAACAGTCCTACGTTCTCGAGAACGTAGGACTGTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015261.1-2774s1c1
Sequence:CCGGCCCTCTGTGATTAGAGCACATCTCGAGATGTGCTCTAATCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-1280s1c1
Sequence:CCGGGCTCTGTTAGAACTGCCTGAACTCGAGTTCAGGCAGTTCTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015261
VALIDATED
NCAPD3 MISSION shRNA shRNA Plasmid DNA
non-SMC condensin II complex, subunit D3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-1622s21c1
Sequence:GTACCGGGCGCCCTTGTGGATGAATTAACTCGAGTTAATTCATCCACAAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-4050s21c1
Sequence:CCGGCCTCAGCTCAAAGGAGATCAACTCGAGTTGATCTCCTTTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-3352s21c1
Sequence:CCGGCCCTCTGTGATTAGAGCACATCTCGAGATGTGCTCTAATCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-1858s21c1
Sequence:CCGGGCTCTGTTAGAACTGCCTGAACTCGAGTTCAGGCAGTTCTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-3476s21c1
Sequence:CCGGTCCGCAACAACGTCATCATTGCTCGAGCAATGATGACGTTGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-5377s21c1
Sequence:CCGGCCCATTCAGATAAGCTATAATCTCGAGATTATAGCTTATCTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-75s1c1
Sequence:CCGGCGCTGGATCTTAGACTCGAATCTCGAGATTCGAGTCTAAGATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-3472s1c1
Sequence:CCGGCCTCAGCTCAAAGGAGATCAACTCGAGTTGATCTCCTTTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-1486s1c1
Sequence:CCGGCCTGATTAACAGTCCTACGTTCTCGAGAACGTAGGACTGTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015261.1-2774s1c1
Sequence:CCGGCCCTCTGTGATTAGAGCACATCTCGAGATGTGCTCTAATCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-1280s1c1
Sequence:CCGGGCTCTGTTAGAACTGCCTGAACTCGAGTTCAGGCAGTTCTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015261
VALIDATED
NCAPD3 MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin II complex, subunit D3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-1622s21c1
Sequence:GTACCGGGCGCCCTTGTGGATGAATTAACTCGAGTTAATTCATCCACAAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-4050s21c1
Sequence:CCGGCCTCAGCTCAAAGGAGATCAACTCGAGTTGATCTCCTTTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-3352s21c1
Sequence:CCGGCCCTCTGTGATTAGAGCACATCTCGAGATGTGCTCTAATCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-1858s21c1
Sequence:CCGGGCTCTGTTAGAACTGCCTGAACTCGAGTTCAGGCAGTTCTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015261.2-3476s21c1
Sequence:CCGGTCCGCAACAACGTCATCATTGCTCGAGCAATGATGACGTTGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015261.2-5377s21c1
Sequence:CCGGCCCATTCAGATAAGCTATAATCTCGAGATTATAGCTTATCTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-75s1c1
Sequence:CCGGCGCTGGATCTTAGACTCGAATCTCGAGATTCGAGTCTAAGATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-3472s1c1
Sequence:CCGGCCTCAGCTCAAAGGAGATCAACTCGAGTTGATCTCCTTTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-1486s1c1
Sequence:CCGGCCTGATTAACAGTCCTACGTTCTCGAGAACGTAGGACTGTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015261.1-2774s1c1
Sequence:CCGGCCCTCTGTGATTAGAGCACATCTCGAGATGTGCTCTAATCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_015261.1-1280s1c1
Sequence:CCGGGCTCTGTTAGAACTGCCTGAACTCGAGTTCAGGCAGTTCTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks