EMAIL THIS PAGE TO A FRIEND

NCAPG2

non-SMC condensin II complex, subunit G2

Synonyms: CAP-G2 CAPG2 LUZP5 MTB hCAP-G2
Gene ID:
Human(54892) Summary: Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPG2 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]
Mouse(76044) non-SMC condensin II complex, subunit G2
Rat(362798) non-SMC condensin II complex, subunit G2
Zebrafish(100037337) non-SMC condensin II complex, subunit G2
domestic cat(101085874) non-SMC condensin II complex, subunit G2
cow(516644) non-SMC condensin II complex, subunit G2
Horse(100057356) non-SMC condensin II complex, subunit G2
dog(475559) non-SMC condensin II complex, subunit G2
chicken(420451) non-SMC condensin II complex, subunit G2
domestic guinea pig(100724295) non-SMC condensin II complex, subunit G2
naked mole-rat(101715656) non-SMC condensin II complex, subunit G2
sheep(101118691) non-SMC condensin II complex, subunit G2
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017760 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017760 Rosetta Predictions human pricing
XM_001061369 Rosetta Predictions rat pricing
XM_343124 Rosetta Predictions rat pricing
NM_133762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350583 predicted 3409
2 SASI_Hs01_00229649 predicted 1002
3 SASI_Hs02_00350584 predicted 3302
4 SASI_Hs01_00229650 predicted 1856
5 SASI_Hs01_00229651 predicted 814
6 SASI_Hs01_00229652 predicted 2067
7 SASI_Hs01_00229654 predicted 2418
8 SASI_Hs01_00229655 predicted 1243
9 SASI_Hs02_00350585 predicted 628
10 SASI_Hs01_00229656 predicted 2406
11 SASI_Hs01_00229653 predicted 2949
12 SASI_Hs01_00229657 predicted 1195
13 SASI_Hs01_00229658 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299799 predicted 1422
2 SASI_Rn02_00299800 predicted 1847
3 SASI_Rn02_00299801 predicted 2703
4 SASI_Rn02_00299802 predicted 219
5 SASI_Rn02_00299803 predicted 449
6 SASI_Rn02_00299804 predicted 2000
7 SASI_Rn02_00299805 predicted 2333
8 SASI_Rn02_00299806 predicted 2849
9 SASI_Rn02_00299807 predicted 1101
10 SASI_Rn02_00299808 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395353 predicted 1419
2 SASI_Rn02_00395354 predicted 1853
3 SASI_Rn02_00395355 predicted 2706
4 SASI_Rn02_00395356 predicted 220
5 SASI_Rn02_00395357 predicted 447
6 SASI_Rn02_00395358 predicted 1998
7 SASI_Rn02_00395359 predicted 2338
8 SASI_Rn02_00395360 predicted 2850
9 SASI_Rn02_00395361 predicted 1101
10 SASI_Rn02_00395362 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338759 predicted 558
2 SASI_Mm02_00338760 predicted 563
3 SASI_Mm01_00066399 predicted 1658
4 SASI_Mm01_00066400 predicted 1334
5 SASI_Mm01_00066401 predicted 2304
6 SASI_Mm02_00338761 predicted 499
7 SASI_Mm01_00066402 predicted 1957
8 SASI_Mm01_00066403 predicted 356
9 SASI_Mm01_00066404 predicted 639
10 SASI_Mm01_00066405 predicted 412
11 SASI_Mm01_00066398 predicted 1507
12 SASI_Mm01_00066406 predicted 2529
13 SASI_Mm01_00066407 predicted 1292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133762
NCAPG2 MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin II complex, subunit G2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133762.3-1618s21c1
Sequence:CCGGCAAGCTGAGCCACCCATTATTCTCGAGAATAATGGGTGGCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133762.3-6351s1c1
Sequence:CCGGCACCAATACTTAACGTATTTACTCGAGTAAATACGTTAAGTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133762.3-4016s21c1
Sequence:CCGGGCCTGTGACTTACCCATTATTCTCGAGAATAATGGGTAAGTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-1030s1c1
Sequence:CCGGGCCAGGAGGTTCTATCAGTATCTCGAGATACTGATAGAACCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133762.2-3132s1c1
Sequence:CCGGCCTCTGACTTACCCATTATTTCTCGAGAAATAATGGGTAAGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-2263s1c1
Sequence:CCGGGCCTGTATCTTCAGGAAGCAACTCGAGTTGCTTCCTGAAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133762.2-3760s1c1
Sequence:CCGGCCTGTAAATATGATGGGTATTCTCGAGAATACCCATCATATTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-2765s1c1
Sequence:CCGGCAATGAGAACTTTGGGAGAATCTCGAGATTCTCCCAAAGTTCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-1751s1c1
Sequence:CCGGCCAAGGCAGAACTGGAATCATCTCGAGATGATTCCAGTTCTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-427s1c1
Sequence:CCGGGCTGCATTGTTGTTTGTTGAACTCGAGTTCAACAAACAACAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-1228s1c1
Sequence:CCGGGCAGGCTTACTAGAAATCATTCTCGAGAATGATTTCTAGTAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133762
NCAPG2 MISSION shRNA shRNA Plasmid DNA
non-SMC condensin II complex, subunit G2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133762.3-1618s21c1
Sequence:CCGGCAAGCTGAGCCACCCATTATTCTCGAGAATAATGGGTGGCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133762.3-6351s1c1
Sequence:CCGGCACCAATACTTAACGTATTTACTCGAGTAAATACGTTAAGTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133762.3-4016s21c1
Sequence:CCGGGCCTGTGACTTACCCATTATTCTCGAGAATAATGGGTAAGTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-1030s1c1
Sequence:CCGGGCCAGGAGGTTCTATCAGTATCTCGAGATACTGATAGAACCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133762.2-3132s1c1
Sequence:CCGGCCTCTGACTTACCCATTATTTCTCGAGAAATAATGGGTAAGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-2263s1c1
Sequence:CCGGGCCTGTATCTTCAGGAAGCAACTCGAGTTGCTTCCTGAAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133762.2-3760s1c1
Sequence:CCGGCCTGTAAATATGATGGGTATTCTCGAGAATACCCATCATATTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-2765s1c1
Sequence:CCGGCAATGAGAACTTTGGGAGAATCTCGAGATTCTCCCAAAGTTCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-1751s1c1
Sequence:CCGGCCAAGGCAGAACTGGAATCATCTCGAGATGATTCCAGTTCTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-427s1c1
Sequence:CCGGGCTGCATTGTTGTTTGTTGAACTCGAGTTCAACAAACAACAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-1228s1c1
Sequence:CCGGGCAGGCTTACTAGAAATCATTCTCGAGAATGATTTCTAGTAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133762
NCAPG2 MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin II complex, subunit G2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133762.3-1618s21c1
Sequence:CCGGCAAGCTGAGCCACCCATTATTCTCGAGAATAATGGGTGGCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133762.3-6351s1c1
Sequence:CCGGCACCAATACTTAACGTATTTACTCGAGTAAATACGTTAAGTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133762.3-4016s21c1
Sequence:CCGGGCCTGTGACTTACCCATTATTCTCGAGAATAATGGGTAAGTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-1030s1c1
Sequence:CCGGGCCAGGAGGTTCTATCAGTATCTCGAGATACTGATAGAACCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133762.2-3132s1c1
Sequence:CCGGCCTCTGACTTACCCATTATTTCTCGAGAAATAATGGGTAAGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-2263s1c1
Sequence:CCGGGCCTGTATCTTCAGGAAGCAACTCGAGTTGCTTCCTGAAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133762.2-3760s1c1
Sequence:CCGGCCTGTAAATATGATGGGTATTCTCGAGAATACCCATCATATTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-2765s1c1
Sequence:CCGGCAATGAGAACTTTGGGAGAATCTCGAGATTCTCCCAAAGTTCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133762.2-1751s1c1
Sequence:CCGGCCAAGGCAGAACTGGAATCATCTCGAGATGATTCCAGTTCTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-427s1c1
Sequence:CCGGGCTGCATTGTTGTTTGTTGAACTCGAGTTCAACAAACAACAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133762.2-1228s1c1
Sequence:CCGGGCAGGCTTACTAGAAATCATTCTCGAGAATGATTTCTAGTAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017760
VALIDATED
NCAPG2 MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin II complex, subunit G2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-869s21c1
Sequence:CCGGATGATCCACGGGACCATTAAACTCGAGTTTAATGGTCCCGTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-3107s21c1
Sequence:CCGGCATGAGTTCATTACTGCTGTTCTCGAGAACAGCAGTAATGAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-3400s21c1
Sequence:CCGGGCATATTATCCTGGTTATTAACTCGAGTTAATAACCAGGATAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-2486s21c1
Sequence:CCGGCCTCGGAAGAAACTTAACCATCTCGAGATGGTTAAGTTTCTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017760.5-3758s21c1
Sequence:CCGGTGCCTAGTGCCTGCGTAAATACTCGAGTATTTACGCAGGCACTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-2455s1c1
Sequence:CCGGCCTCGGAAGAAACTTAACCATCTCGAGATGGTTAAGTTTCTTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017760.4-4135s1c1
Sequence:CCGGGCTAAGGTATAAGCAGACATACTCGAGTATGTCTGCTTATACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017760.4-4108s1c1
Sequence:CCGGCCTTGTATCATTGCTGTCATTCTCGAGAATGACAGCAATGATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017760.4-3378s1c1
Sequence:CCGGCCTGGTTATTAATGCAGGTAACTCGAGTTACCTGCATTAATAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017760.4-2731s1c1
Sequence:CCGGCATAGGGTCATTTATCAGCAACTCGAGTTGCTGATAAATGACCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017760.4-4749s1c1
Sequence:CCGGGCTTCTCAAATTGCTGGGATTCTCGAGAATCCCAGCAATTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-1816s1c1
Sequence:CCGGGCAAAGCTGATTCACGTTATTCTCGAGAATAACGTGAATCAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-3076s1c1
Sequence:CCGGCATGAGTTCATTACTGCTGTTCTCGAGAACAGCAGTAATGAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017760
VALIDATED
NCAPG2 MISSION shRNA shRNA Plasmid DNA
non-SMC condensin II complex, subunit G2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-869s21c1
Sequence:CCGGATGATCCACGGGACCATTAAACTCGAGTTTAATGGTCCCGTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-3107s21c1
Sequence:CCGGCATGAGTTCATTACTGCTGTTCTCGAGAACAGCAGTAATGAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-3400s21c1
Sequence:CCGGGCATATTATCCTGGTTATTAACTCGAGTTAATAACCAGGATAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-2486s21c1
Sequence:CCGGCCTCGGAAGAAACTTAACCATCTCGAGATGGTTAAGTTTCTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017760.5-3758s21c1
Sequence:CCGGTGCCTAGTGCCTGCGTAAATACTCGAGTATTTACGCAGGCACTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-2455s1c1
Sequence:CCGGCCTCGGAAGAAACTTAACCATCTCGAGATGGTTAAGTTTCTTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017760.4-4135s1c1
Sequence:CCGGGCTAAGGTATAAGCAGACATACTCGAGTATGTCTGCTTATACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017760.4-4108s1c1
Sequence:CCGGCCTTGTATCATTGCTGTCATTCTCGAGAATGACAGCAATGATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017760.4-3378s1c1
Sequence:CCGGCCTGGTTATTAATGCAGGTAACTCGAGTTACCTGCATTAATAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017760.4-2731s1c1
Sequence:CCGGCATAGGGTCATTTATCAGCAACTCGAGTTGCTGATAAATGACCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017760.4-4749s1c1
Sequence:CCGGGCTTCTCAAATTGCTGGGATTCTCGAGAATCCCAGCAATTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-1816s1c1
Sequence:CCGGGCAAAGCTGATTCACGTTATTCTCGAGAATAACGTGAATCAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-3076s1c1
Sequence:CCGGCATGAGTTCATTACTGCTGTTCTCGAGAACAGCAGTAATGAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017760
VALIDATED
NCAPG2 MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin II complex, subunit G2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-869s21c1
Sequence:CCGGATGATCCACGGGACCATTAAACTCGAGTTTAATGGTCCCGTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-3107s21c1
Sequence:CCGGCATGAGTTCATTACTGCTGTTCTCGAGAACAGCAGTAATGAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-3400s21c1
Sequence:CCGGGCATATTATCCTGGTTATTAACTCGAGTTAATAACCAGGATAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017760.5-2486s21c1
Sequence:CCGGCCTCGGAAGAAACTTAACCATCTCGAGATGGTTAAGTTTCTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017760.5-3758s21c1
Sequence:CCGGTGCCTAGTGCCTGCGTAAATACTCGAGTATTTACGCAGGCACTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-2455s1c1
Sequence:CCGGCCTCGGAAGAAACTTAACCATCTCGAGATGGTTAAGTTTCTTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017760.4-4135s1c1
Sequence:CCGGGCTAAGGTATAAGCAGACATACTCGAGTATGTCTGCTTATACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017760.4-4108s1c1
Sequence:CCGGCCTTGTATCATTGCTGTCATTCTCGAGAATGACAGCAATGATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017760.4-3378s1c1
Sequence:CCGGCCTGGTTATTAATGCAGGTAACTCGAGTTACCTGCATTAATAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017760.4-2731s1c1
Sequence:CCGGCATAGGGTCATTTATCAGCAACTCGAGTTGCTGATAAATGACCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017760.4-4749s1c1
Sequence:CCGGGCTTCTCAAATTGCTGGGATTCTCGAGAATCCCAGCAATTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-1816s1c1
Sequence:CCGGGCAAAGCTGATTCACGTTATTCTCGAGAATAACGTGAATCAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017760.4-3076s1c1
Sequence:CCGGCATGAGTTCATTACTGCTGTTCTCGAGAACAGCAGTAATGAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks