EMAIL THIS PAGE TO A FRIEND

NCBP1

nuclear cap binding protein subunit 1, 80kDa

Synonyms: CBP80 NCBP Sto1
UniProtKB ID: Q09161, B2R718, Q59G76, Q5T1V0, Q5T7X2
Gene ID:
Human(4686) Summary: The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]
Mouse(433702) nuclear cap binding protein subunit 1
Rat(298075) nuclear cap binding protein subunit 1
chicken(427379) nuclear cap binding protein subunit 1, 80kDa
dog(474772) nuclear cap binding protein subunit 1, 80kDa
cow(100124428) nuclear cap binding protein subunit 1, 80kDa
Horse(100064523) nuclear cap binding protein subunit 1, 80kDa
domestic cat(101082602) nuclear cap binding protein subunit 1, 80kDa
sheep(101104206) nuclear cap binding protein subunit 1, 80kDa
naked mole-rat(101698074) nuclear cap binding protein subunit 1, 80kDa
domestic guinea pig(100735557) nuclear cap binding protein subunit 1, 80kDa
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002486 Rosetta Predictions human pricing
NM_001014785 Rosetta Predictions rat pricing
NM_001033201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102847 predicted 1080
2 SASI_Hs01_00102848 predicted 506
3 SASI_Hs02_00333922 predicted 1206
4 SASI_Hs01_00102850 predicted 1985
5 SASI_Hs01_00102851 predicted 1554
6 SASI_Hs01_00102852 predicted 2189
7 SASI_Hs01_00102853 predicted 1094
8 SASI_Hs02_00333923 predicted 702
9 SASI_Hs01_00102854 predicted 1828
10 SASI_Hs02_00333924 predicted 1497
11 SASI_Hs01_00102849 predicted 2474
12 SASI_Hs01_00102855 predicted 2104
13 SASI_Hs01_00102856 predicted 2588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047648 predicted 1439
2 SASI_Rn01_00047649 predicted 688
3 SASI_Rn01_00047650 predicted 359
4 SASI_Rn01_00047651 predicted 435
5 SASI_Rn01_00047652 predicted 1108
6 SASI_Rn01_00047653 predicted 381
7 SASI_Rn02_00201895 predicted 345
8 SASI_Rn01_00047654 predicted 1455
9 SASI_Rn01_00047655 predicted 1188
10 SASI_Rn01_00047656 predicted 1300
11 SASI_Rn01_00047657 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174779 predicted 2190
2 SASI_Mm01_00174780 predicted 576
3 SASI_Mm01_00174782 predicted 634
4 SASI_Mm01_00174783 predicted 1380
5 SASI_Mm01_00174784 predicted 1565
6 SASI_Mm01_00174785 predicted 1724
7 SASI_Mm01_00174788 predicted 1645
8 SASI_Mm01_00174786 predicted 534
9 SASI_Mm01_00174787 predicted 581
10 SASI_Mm02_00288324 predicted 1630
11 SASI_Mm01_00174781 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002486
VALIDATED
NCBP1 MISSION shRNA Bacterial Glycerol Stock
nuclear cap binding protein subunit 1, 80kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-2187s1c1
Sequence:CCGGGCACTCTACAATTCGTAAGATCTCGAGATCTTACGAATTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-1300s1c1
Sequence:CCGGCCCTTGAACTACCACATAGTTCTCGAGAACTATGTGGTAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-2394s1c1
Sequence:CCGGCCTCGTTATATTTCAGCGGTTCTCGAGAACCGCTGAAATATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002486.2-756s1c1
Sequence:CCGGGCGACGAGATTGGTATGTGTACTCGAGTACACATACCAATCTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002486.2-854s1c1
Sequence:CCGGCCAACACTGAAAGCTATCTTACTCGAGTAAGATAGCTTTCAGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002486.4-1836s21c2
Sequence:CCGGGTCTTACCATCAGCGTATATTCTCGAGAATATACGCTGATGGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002486.4-2592s21c2
Sequence:CCGGCGTTATATTTCAGCGGTTTATCTCGAGATAAACCGCTGAAATATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-647s21c2
Sequence:GTACCGGACTACAAGAGCAAGATCTTAACTCGAGTTAAGATCTTGCTCTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-676s21c2
Sequence:CCGGTGTACAGTTGCACGCCTATTACTCGAGTAATAGGCGTGCAACTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-3147s21c2
Sequence:CCGGGTCAACCTTACATAGTATATACTCGAGTATATACTATGTAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002486
VALIDATED
NCBP1 MISSION shRNA shRNA Plasmid DNA
nuclear cap binding protein subunit 1, 80kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-2187s1c1
Sequence:CCGGGCACTCTACAATTCGTAAGATCTCGAGATCTTACGAATTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-1300s1c1
Sequence:CCGGCCCTTGAACTACCACATAGTTCTCGAGAACTATGTGGTAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-2394s1c1
Sequence:CCGGCCTCGTTATATTTCAGCGGTTCTCGAGAACCGCTGAAATATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002486.2-756s1c1
Sequence:CCGGGCGACGAGATTGGTATGTGTACTCGAGTACACATACCAATCTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002486.2-854s1c1
Sequence:CCGGCCAACACTGAAAGCTATCTTACTCGAGTAAGATAGCTTTCAGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002486.4-1836s21c2
Sequence:CCGGGTCTTACCATCAGCGTATATTCTCGAGAATATACGCTGATGGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002486.4-2592s21c2
Sequence:CCGGCGTTATATTTCAGCGGTTTATCTCGAGATAAACCGCTGAAATATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-647s21c2
Sequence:GTACCGGACTACAAGAGCAAGATCTTAACTCGAGTTAAGATCTTGCTCTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-676s21c2
Sequence:CCGGTGTACAGTTGCACGCCTATTACTCGAGTAATAGGCGTGCAACTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-3147s21c2
Sequence:CCGGGTCAACCTTACATAGTATATACTCGAGTATATACTATGTAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002486
VALIDATED
NCBP1 MISSION shRNA Lentiviral Transduction Particles
nuclear cap binding protein subunit 1, 80kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-2187s1c1
Sequence:CCGGGCACTCTACAATTCGTAAGATCTCGAGATCTTACGAATTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-1300s1c1
Sequence:CCGGCCCTTGAACTACCACATAGTTCTCGAGAACTATGTGGTAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002486.2-2394s1c1
Sequence:CCGGCCTCGTTATATTTCAGCGGTTCTCGAGAACCGCTGAAATATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002486.2-756s1c1
Sequence:CCGGGCGACGAGATTGGTATGTGTACTCGAGTACACATACCAATCTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002486.2-854s1c1
Sequence:CCGGCCAACACTGAAAGCTATCTTACTCGAGTAAGATAGCTTTCAGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002486.4-1836s21c2
Sequence:CCGGGTCTTACCATCAGCGTATATTCTCGAGAATATACGCTGATGGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002486.4-2592s21c2
Sequence:CCGGCGTTATATTTCAGCGGTTTATCTCGAGATAAACCGCTGAAATATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-647s21c2
Sequence:GTACCGGACTACAAGAGCAAGATCTTAACTCGAGTTAAGATCTTGCTCTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-676s21c2
Sequence:CCGGTGTACAGTTGCACGCCTATTACTCGAGTAATAGGCGTGCAACTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002486.4-3147s21c2
Sequence:CCGGGTCAACCTTACATAGTATATACTCGAGTATATACTATGTAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033201
VALIDATED
NCBP1 MISSION shRNA Bacterial Glycerol Stock
nuclear cap binding protein subunit 1, 80kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-577s21c1
Sequence:CCGGTTACCTGAGAAGCTAACAATTCTCGAGAATTGTTAGCTTCTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-2530s21c1
Sequence:CCGGACGGATGGGACCAGTATATTGCTCGAGCAATATACTGGTCCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-660s21c1
Sequence:CCGGAGCTATGATTCGTCAACTTAACTCGAGTTAAGTTGACGAATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-2926s21c1
Sequence:CCGGCACAACTTTCCTGTGATAAATCTCGAGATTTATCACAGGAAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-1719s21c1
Sequence:CCGGGTCTTACCATCAACATATATTCTCGAGAATATATGTTGATGGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033201
VALIDATED
NCBP1 MISSION shRNA shRNA Plasmid DNA
nuclear cap binding protein subunit 1, 80kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-577s21c1
Sequence:CCGGTTACCTGAGAAGCTAACAATTCTCGAGAATTGTTAGCTTCTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-2530s21c1
Sequence:CCGGACGGATGGGACCAGTATATTGCTCGAGCAATATACTGGTCCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-660s21c1
Sequence:CCGGAGCTATGATTCGTCAACTTAACTCGAGTTAAGTTGACGAATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-2926s21c1
Sequence:CCGGCACAACTTTCCTGTGATAAATCTCGAGATTTATCACAGGAAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-1719s21c1
Sequence:CCGGGTCTTACCATCAACATATATTCTCGAGAATATATGTTGATGGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033201
VALIDATED
NCBP1 MISSION shRNA Lentiviral Transduction Particles
nuclear cap binding protein subunit 1, 80kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-577s21c1
Sequence:CCGGTTACCTGAGAAGCTAACAATTCTCGAGAATTGTTAGCTTCTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-2530s21c1
Sequence:CCGGACGGATGGGACCAGTATATTGCTCGAGCAATATACTGGTCCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-660s21c1
Sequence:CCGGAGCTATGATTCGTCAACTTAACTCGAGTTAAGTTGACGAATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-2926s21c1
Sequence:CCGGCACAACTTTCCTGTGATAAATCTCGAGATTTATCACAGGAAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033201.3-1719s21c1
Sequence:CCGGGTCTTACCATCAACATATATTCTCGAGAATATATGTTGATGGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks