EMAIL THIS PAGE TO A FRIEND

NCF1

neutrophil cytosolic factor 1

Synonyms: NCF1A NOXO2 SH3PXD1A p47phox
Gene ID:
Human(653361) Summary: The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
Mouse(17969) neutrophil cytosolic factor 1
Rat(114553) neutrophil cytosolic factor 1
Zebrafish(378966) neutrophil cytosolic factor 1
chicken(417485) neutrophil cytosolic factor 1
cow(281345) neutrophil cytosolic factor 1
domestic cat(101098840) neutrophil cytosolic factor 1
dog(607700) neutrophil cytosolic factor 1
naked mole-rat(101721191) neutrophil cytosolic factor 1
Domestic Rabbit(100008803) neutrophil cytosolic factor 1
domestic guinea pig(100726055) neutrophil cytosolic factor 1
sheep(780489) neutrophil cytosolic factor 1
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103274 Anti-NCF1 (76-90) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2501983 Anti-Ncf1 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human, mouse, rat, canine, bovine
ELISA, western blot pricing
HPA047836 Anti-NCF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA052095 Anti-NCF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2500674 Anti-NCF1/P47PHOX antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, rabbit, human, mouse, bovine
ELISA, western blot pricing
SAB4502808 Anti-p47 PHOX, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4502809 Anti-p47 PHOX, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing
SAB4502810 Anti-p47 PHOX, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4502811 Anti-p47 PHOX, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4502812 Anti-p47 PHOX, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504284 Anti-phospho-Neutrophil Cytosol Factor 1 (pSer304) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301269 Anti-phospho-Neutrophil Cytosol Factor 1 (pSer304) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504285 Anti-phospho-Neutrophil Cytosol Factor 1 (pSer328) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4504721 Anti-phospho-p47 phox (pSer345) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301368 Anti-phospho-p47 phox (pSer345) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504289 Anti-phospho-p47 phox (pSer359) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301550 Anti-phospho-p47 phox (pSer359) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504288 Anti-phospho-p47 phox (pSer370) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000265 Rosetta Predictions human pricing
XM_928908 Rosetta Predictions human pricing
XM_933267 Rosetta Predictions human pricing
XM_933270 Rosetta Predictions human pricing
XM_933273 Rosetta Predictions human pricing
XM_933285 Rosetta Predictions human pricing
XM_933287 Rosetta Predictions human pricing
XM_933290 Rosetta Predictions human pricing
XM_933292 Rosetta Predictions human pricing
NM_053734 Rosetta Predictions rat pricing
NM_010876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302212 predicted 876
2 SASI_Hs02_00302213 predicted 717
3 SASI_Hs02_00302214 predicted 550
4 SASI_Hs01_00084995 predicted 472
5 SASI_Hs01_00084997 predicted 500
6 SASI_Hs01_00084998 predicted 822
7 SASI_Hs01_00084999 predicted 703
8 SASI_Hs02_00302215 predicted 480
9 SASI_Hs01_00085000 predicted 635
10 SASI_Hs02_00302216 predicted 882
11 SASI_Hs01_00084994 predicted 757
12 SASI_Hs01_00084996 predicted 874
13 SASI_Hs01_00085001 predicted 545
14 SASI_Hs01_00085002 predicted 711
15 SASI_Hs01_00085003 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293103 predicted 459
2 SASI_Hs01_00293104 predicted 537
3 SASI_Hs01_00293105 predicted 456
4 SASI_Hs01_00293106 predicted 480
5 SASI_Hs01_00293107 predicted 1128
6 SASI_Hs01_00293108 predicted 623
7 SASI_Hs01_00293109 predicted 822
8 SASI_Hs01_00293110 predicted 829
9 SASI_Hs01_00293111 predicted 614
10 SASI_Hs01_00293112 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301617 predicted 249
2 SASI_Hs01_00301618 predicted 250
3 SASI_Hs01_00301619 predicted 243
4 SASI_Hs01_00301620 predicted 303
5 SASI_Hs01_00301621 predicted 241
6 SASI_Hs01_00301622 predicted 330
7 SASI_Hs01_00301623 predicted 267
8 SASI_Hs01_00301624 predicted 324
9 SASI_Hs01_00301625 predicted 245
10 SASI_Hs01_00301626 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256507 predicted 578
2 SASI_Hs01_00256508 predicted 962
3 SASI_Hs01_00256509 predicted 493
4 SASI_Hs01_00256510 predicted 517
5 SASI_Hs01_00256511 predicted 1302
6 SASI_Hs01_00256512 predicted 1366
7 SASI_Hs01_00256513 predicted 815
8 SASI_Hs01_00256514 predicted 1126
9 SASI_Hs01_00256515 predicted 1372
10 SASI_Hs01_00256516 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289267 predicted 452
2 SASI_Hs01_00289268 predicted 528
3 SASI_Hs01_00289269 predicted 927
4 SASI_Hs01_00289270 predicted 458
5 SASI_Hs01_00289271 predicted 835
6 SASI_Hs01_00289272 predicted 478
7 SASI_Hs01_00289273 predicted 769
8 SASI_Hs01_00289274 predicted 846
9 SASI_Hs01_00289275 predicted 894
10 SASI_Hs01_00289276 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283469 predicted 533
2 SASI_Hs01_00283470 predicted 455
3 SASI_Hs01_00283471 predicted 329
4 SASI_Hs01_00283472 predicted 482
5 SASI_Hs01_00283473 predicted 862
6 SASI_Hs01_00283474 predicted 705
7 SASI_Hs01_00283475 predicted 468
8 SASI_Hs01_00283476 predicted 537
9 SASI_Hs01_00283477 predicted 467
10 SASI_Hs01_00283478 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299920 predicted 290
2 SASI_Hs01_00299921 predicted 342
3 SASI_Hs01_00299922 predicted 205
4 SASI_Hs01_00299923 predicted 381
5 SASI_Hs01_00299924 predicted 361
6 SASI_Hs01_00299925 predicted 355
7 SASI_Hs01_00299926 predicted 334
8 SASI_Hs01_00299927 predicted 206
9 SASI_Hs01_00299928 predicted 330
10 SASI_Hs01_00299929 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301093 predicted 920
2 SASI_Hs01_00301094 predicted 1246
3 SASI_Hs01_00301095 predicted 1399
4 SASI_Hs01_00301096 predicted 1155
5 SASI_Hs01_00301097 predicted 1336
6 SASI_Hs01_00301098 predicted 1478
7 SASI_Hs01_00301099 predicted 1324
8 SASI_Hs01_00301100 predicted 1312
9 SASI_Hs01_00301101 predicted 1162
10 SASI_Hs01_00301102 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289840 predicted 475
2 SASI_Hs01_00289841 predicted 527
3 SASI_Hs01_00289842 predicted 388
4 SASI_Hs01_00289843 predicted 571
5 SASI_Hs01_00289844 predicted 557
6 SASI_Hs01_00289845 predicted 538
7 SASI_Hs01_00289846 predicted 524
8 SASI_Hs01_00289847 predicted 391
9 SASI_Hs01_00289848 predicted 323
10 SASI_Hs01_00289849 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266506 predicted 392
2 SASI_Rn02_00266507 predicted 485
3 SASI_Rn02_00266508 predicted 823
4 SASI_Rn02_00266509 predicted 1207
5 SASI_Rn02_00266510 predicted 544
6 SASI_Rn02_00266511 predicted 509
7 SASI_Rn02_00266512 predicted 1251
8 SASI_Rn02_00266513 predicted 940
9 SASI_Rn02_00266514 predicted 417
10 SASI_Rn02_00266515 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319552 predicted 451
2 SASI_Mm01_00079105 predicted 1242
3 SASI_Mm01_00079107 predicted 873
4 SASI_Mm02_00319553 predicted 1312
5 SASI_Mm02_00319554 predicted 467
6 SASI_Mm01_00079108 predicted 483
7 SASI_Mm02_00319555 predicted 1330
8 SASI_Mm01_00079110 predicted 1497
9 SASI_Mm01_00079111 predicted 477
10 SASI_Mm01_00079112 predicted 1370
11 SASI_Mm01_00079106 predicted 1212
12 SASI_Mm01_00079109 predicted 301
13 SASI_Mm01_00079113 predicted 413
14 SASI_Mm01_00079114 predicted 1177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000265
NCF1 MISSION shRNA Bacterial Glycerol Stock
neutrophil cytosolic factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-558s21c1
Sequence:CCGGCCATTGCCAACTACGAGAAGACTCGAGTCTTCTCGTAGTTGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-342s21c1
Sequence:CCGGAGGGCACACTTACCGAGTACTCTCGAGAGTACTCGGTAAGTGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-819s21c1
Sequence:CCGGGTGAAGCTGTTGAGGTCATTCCTCGAGGAATGACCTCAACAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-648s21c1
Sequence:CCGGGGTGGTTCTGTCAGATGAAAGCTCGAGCTTTCATCTGACAGAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-144s21c1
Sequence:CCGGTGTACATGTTCCTGGTGAAATCTCGAGATTTCACCAGGAACATGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-207s1c1
Sequence:CCGGCAATCCAGAGAACAGGATCATCTCGAGATGATCCTGTTCTCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-146s1c1
Sequence:CCGGCCGAGATCTACGAGTTCCATACTCGAGTATGGAACTCGTAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-75s1c1
Sequence:CCGGCCAGCACTATGTGTACATGTTCTCGAGAACATGTACACATAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-594s1c1
Sequence:CCGGGTTCTGTCAGATGAAAGCAAACTCGAGTTTGCTTTCATCTGACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-421s1c1
Sequence:CCGGGAGACATACTTGATGCCCAAACTCGAGTTTGGGCATCAAGTATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000265
NCF1 MISSION shRNA shRNA Plasmid DNA
neutrophil cytosolic factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-558s21c1
Sequence:CCGGCCATTGCCAACTACGAGAAGACTCGAGTCTTCTCGTAGTTGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-342s21c1
Sequence:CCGGAGGGCACACTTACCGAGTACTCTCGAGAGTACTCGGTAAGTGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-819s21c1
Sequence:CCGGGTGAAGCTGTTGAGGTCATTCCTCGAGGAATGACCTCAACAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-648s21c1
Sequence:CCGGGGTGGTTCTGTCAGATGAAAGCTCGAGCTTTCATCTGACAGAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-144s21c1
Sequence:CCGGTGTACATGTTCCTGGTGAAATCTCGAGATTTCACCAGGAACATGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-207s1c1
Sequence:CCGGCAATCCAGAGAACAGGATCATCTCGAGATGATCCTGTTCTCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-146s1c1
Sequence:CCGGCCGAGATCTACGAGTTCCATACTCGAGTATGGAACTCGTAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-75s1c1
Sequence:CCGGCCAGCACTATGTGTACATGTTCTCGAGAACATGTACACATAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-594s1c1
Sequence:CCGGGTTCTGTCAGATGAAAGCAAACTCGAGTTTGCTTTCATCTGACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-421s1c1
Sequence:CCGGGAGACATACTTGATGCCCAAACTCGAGTTTGGGCATCAAGTATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000265
NCF1 MISSION shRNA Lentiviral Transduction Particles
neutrophil cytosolic factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-558s21c1
Sequence:CCGGCCATTGCCAACTACGAGAAGACTCGAGTCTTCTCGTAGTTGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-342s21c1
Sequence:CCGGAGGGCACACTTACCGAGTACTCTCGAGAGTACTCGGTAAGTGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-819s21c1
Sequence:CCGGGTGAAGCTGTTGAGGTCATTCCTCGAGGAATGACCTCAACAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-648s21c1
Sequence:CCGGGGTGGTTCTGTCAGATGAAAGCTCGAGCTTTCATCTGACAGAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000265.4-144s21c1
Sequence:CCGGTGTACATGTTCCTGGTGAAATCTCGAGATTTCACCAGGAACATGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-207s1c1
Sequence:CCGGCAATCCAGAGAACAGGATCATCTCGAGATGATCCTGTTCTCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-146s1c1
Sequence:CCGGCCGAGATCTACGAGTTCCATACTCGAGTATGGAACTCGTAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-75s1c1
Sequence:CCGGCCAGCACTATGTGTACATGTTCTCGAGAACATGTACACATAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-594s1c1
Sequence:CCGGGTTCTGTCAGATGAAAGCAAACTCGAGTTTGCTTTCATCTGACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000265.1-421s1c1
Sequence:CCGGGAGACATACTTGATGCCCAAACTCGAGTTTGGGCATCAAGTATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010876
NCF1 MISSION shRNA Bacterial Glycerol Stock
neutrophil cytosolic factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-244s1c1
Sequence:CCGGCCCAGGTGGTTTGATGGACAACTCGAGTTGTCCATCAAACCACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-84s1c1
Sequence:CCGGTGTGTACATGTTCCTGGTTAACTCGAGTTAACCAGGAACATGTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-475s1c1
Sequence:CCGGCCCATCATCCTTCAGACCTATCTCGAGATAGGTCTGAAGGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-828s1c1
Sequence:CCGGCGGCTATTTCCCATCCATGTACTCGAGTACATGGATGGGAAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-697s1c1
Sequence:CCGGGAACCGTATGTAACCATCAAACTCGAGTTTGATGGTTACATACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010876
NCF1 MISSION shRNA shRNA Plasmid DNA
neutrophil cytosolic factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-244s1c1
Sequence:CCGGCCCAGGTGGTTTGATGGACAACTCGAGTTGTCCATCAAACCACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-84s1c1
Sequence:CCGGTGTGTACATGTTCCTGGTTAACTCGAGTTAACCAGGAACATGTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-475s1c1
Sequence:CCGGCCCATCATCCTTCAGACCTATCTCGAGATAGGTCTGAAGGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-828s1c1
Sequence:CCGGCGGCTATTTCCCATCCATGTACTCGAGTACATGGATGGGAAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-697s1c1
Sequence:CCGGGAACCGTATGTAACCATCAAACTCGAGTTTGATGGTTACATACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010876
NCF1 MISSION shRNA Lentiviral Transduction Particles
neutrophil cytosolic factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-244s1c1
Sequence:CCGGCCCAGGTGGTTTGATGGACAACTCGAGTTGTCCATCAAACCACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-84s1c1
Sequence:CCGGTGTGTACATGTTCCTGGTTAACTCGAGTTAACCAGGAACATGTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-475s1c1
Sequence:CCGGCCCATCATCCTTCAGACCTATCTCGAGATAGGTCTGAAGGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-828s1c1
Sequence:CCGGCGGCTATTTCCCATCCATGTACTCGAGTACATGGATGGGAAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010876.2-697s1c1
Sequence:CCGGGAACCGTATGTAACCATCAAACTCGAGTTTGATGGTTACATACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks