EMAIL THIS PAGE TO A FRIEND

NCOA1

nuclear receptor coactivator 1

Synonyms: F-SRC-1 KAT13A RIP160 SRC1 bHLHe42 bHLHe74
Gene ID:
Human(8648) Summary: The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(17977) nuclear receptor coactivator 1
Rat(313929) nuclear receptor coactivator 1
Zebrafish(563288) nuclear receptor coactivator 1
dog(475684) nuclear receptor coactivator 1
domestic cat(101094588) nuclear receptor coactivator 1
cow(525346) nuclear receptor coactivator 1
Horse(100056042) nuclear receptor coactivator 1
chicken(422016) nuclear receptor coactivator 1
domestic guinea pig(100722913) nuclear receptor coactivator 1
naked mole-rat(101726578) nuclear receptor coactivator 1
sheep(101107264) nuclear receptor coactivator 1
244 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104088 Anti-NCOA1 antibody produced in rabbit affinity isolated antibody pig, guinea pig, horse, mouse, rat, rabbit, canine, human, bovine
western blot pricing
HPA070213 Anti-NCOA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA070520 Anti-NCOA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1300875 Anti-SRC1 (C-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1306786 ANTI-SRC1 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1300410 Anti-SRC1 (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, western blot pricing
SAB1307120 ANTI-SRC1(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306922 ANTI-SRC1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2702164 Monoclonal Anti-NCOA1 antibody produced in mouse monkey, rat, human, mouse
ChIP, immunoprecipitation, western blot pricing
PLA0093 Rabbit anti-SRC1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, primate, chimpanzee, gorilla, gibbon, rhesus monkey
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003743 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003743 Rosetta Predictions human pricing
NM_147223 Rosetta Predictions human pricing
NM_147233 Rosetta Predictions human pricing
NM_001108012 Rosetta Predictions rat pricing
NM_010881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177579 predicted 514
2 SASI_Hs02_00336200 predicted 1014
3 SASI_Hs01_00177580 predicted 556
4 SASI_Hs01_00177581 predicted 1404
5 SASI_Hs01_00177585 predicted 668
6 SASI_Hs01_00177586 predicted 2042
7 SASI_Hs01_00177587 predicted 2291
8 SASI_Hs01_00177588 predicted 1796
9 SASI_Hs02_00336201 predicted 3641
10 SASI_Hs02_00336202 predicted 1315
11 SASI_Hs01_00177582 predicted 836
12 SASI_Hs01_00177583 predicted 896
13 SASI_Hs01_00177584 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233181 predicted 517
2 SASI_Hs02_00365549 predicted 1018
3 SASI_Hs01_00233182 predicted 559
4 SASI_Hs01_00233183 predicted 1406
5 SASI_Hs01_00233187 predicted 669
6 SASI_Hs01_00233188 predicted 2044
7 SASI_Hs01_00233189 predicted 2293
8 SASI_Hs01_00233190 predicted 1795
9 SASI_Hs02_00365550 predicted 3638
10 SASI_Hs02_00365551 predicted 1314
11 SASI_Hs01_00233184 predicted 837
12 SASI_Hs01_00233185 predicted 888
13 SASI_Hs01_00233186 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014403 predicted 523
2 SASI_Hs02_00365552 predicted 1012
3 SASI_Hs01_00014404 predicted 554
4 SASI_Hs01_00014405 predicted 1406
5 SASI_Hs01_00014409 predicted 666
6 SASI_Hs01_00014410 predicted 2043
7 SASI_Hs01_00014411 predicted 2296
8 SASI_Hs01_00014412 predicted 1790
9 SASI_Hs02_00365553 predicted 3636
10 SASI_Hs02_00365554 predicted 1314
11 SASI_Hs01_00014406 predicted 839
12 SASI_Hs01_00014407 predicted 897
13 SASI_Hs01_00014408 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234495 predicted 1309
2 SASI_Rn02_00234496 predicted 688
3 SASI_Rn02_00234497 predicted 3397
4 SASI_Rn02_00234498 predicted 3589
5 SASI_Rn02_00234499 predicted 1464
6 SASI_Rn02_00234500 predicted 2239
7 SASI_Rn02_00234501 predicted 1972
8 SASI_Rn02_00234502 predicted 1770
9 SASI_Rn02_00234503 predicted 1247
10 SASI_Rn02_00234504 predicted 2235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091811 predicted 1383
2 SASI_Mm01_00091812 predicted 1596
3 SASI_Mm01_00091813 predicted 2062
4 SASI_Mm01_00091814 predicted 786
5 SASI_Mm01_00091815 predicted 2910
6 SASI_Mm01_00091816 predicted 3235
7 SASI_Mm01_00091817 predicted 3879
8 SASI_Mm01_00091818 predicted 1107
9 SASI_Mm01_00091819 predicted 2977
10 SASI_Mm01_00091820 predicted 2538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010881
VALIDATED
NCOA1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010881.2-2344s21c1
Sequence:CCGGTATGAATGAAGGACCCAATAACTCGAGTTATTGGGTCCTTCATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010881.2-931s21c1
Sequence:CCGGAGTAGATCAGATACAGCTAATCTCGAGATTAGCTGTATCTGATCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010881.1-5004s1c1
Sequence:CCGGCAGCAGCTACTGACTGAATAACTCGAGTTATTCAGTCAGTAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010881.1-4150s1c1
Sequence:CCGGCCCACCAAACTATGGTACAAACTCGAGTTTGTACCATAGTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-2223s1c1
Sequence:CCGGCCTATTCAAATATCCCAGTAACTCGAGTTACTGGGATATTTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-1777s1c1
Sequence:CCGGCCGAATAAATCCCTCAGTCAACTCGAGTTGACTGAGGGATTTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-1190s1c1
Sequence:CCGGCGCCGAAATAGCCATACATTTCTCGAGAAATGTATGGCTATTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010881
VALIDATED
NCOA1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010881.2-2344s21c1
Sequence:CCGGTATGAATGAAGGACCCAATAACTCGAGTTATTGGGTCCTTCATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010881.2-931s21c1
Sequence:CCGGAGTAGATCAGATACAGCTAATCTCGAGATTAGCTGTATCTGATCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010881.1-5004s1c1
Sequence:CCGGCAGCAGCTACTGACTGAATAACTCGAGTTATTCAGTCAGTAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010881.1-4150s1c1
Sequence:CCGGCCCACCAAACTATGGTACAAACTCGAGTTTGTACCATAGTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-2223s1c1
Sequence:CCGGCCTATTCAAATATCCCAGTAACTCGAGTTACTGGGATATTTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-1777s1c1
Sequence:CCGGCCGAATAAATCCCTCAGTCAACTCGAGTTGACTGAGGGATTTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-1190s1c1
Sequence:CCGGCGCCGAAATAGCCATACATTTCTCGAGAAATGTATGGCTATTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010881
VALIDATED
NCOA1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010881.2-2344s21c1
Sequence:CCGGTATGAATGAAGGACCCAATAACTCGAGTTATTGGGTCCTTCATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010881.2-931s21c1
Sequence:CCGGAGTAGATCAGATACAGCTAATCTCGAGATTAGCTGTATCTGATCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010881.1-5004s1c1
Sequence:CCGGCAGCAGCTACTGACTGAATAACTCGAGTTATTCAGTCAGTAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010881.1-4150s1c1
Sequence:CCGGCCCACCAAACTATGGTACAAACTCGAGTTTGTACCATAGTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-2223s1c1
Sequence:CCGGCCTATTCAAATATCCCAGTAACTCGAGTTACTGGGATATTTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-1777s1c1
Sequence:CCGGCCGAATAAATCCCTCAGTCAACTCGAGTTGACTGAGGGATTTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010881.1-1190s1c1
Sequence:CCGGCGCCGAAATAGCCATACATTTCTCGAGAAATGTATGGCTATTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003743
VALIDATED
NCOA1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-1996s21c1
Sequence:CCGGGCTGAGTCCAAAGATAACAAACTCGAGTTTGTTATCTTTGGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-3620s21c1
Sequence:CCGGACCGACAGAGGCAGCTAATACCTCGAGGTATTAGCTGCCTCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-2189s21c1
Sequence:CCGGAGTTACGGCATGCTGATATAGCTCGAGCTATATCAGCATGCCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003743.4-4687s21c1
Sequence:CCGGCTTCAGGTCGTAGCATTTGGACTCGAGTCCAAATGCTACGACCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003743.x-1939s1c1
Sequence:CCGGGCTGAGTCCAAAGATAACAAACTCGAGTTTGTTATCTTTGGACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-1536s1c1
Sequence:CCGGCGGAAGTCAGATTGTAGCCAACTCGAGTTGGCTACAATCTGACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-3165s1c1
Sequence:CCGGCAACCTTTATTCCCAGCCTTACTCGAGTAAGGCTGGGAATAAAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003743.x-4630s1c1
Sequence:CCGGCTTCAGGTCGTAGCATTTGGACTCGAGTCCAAATGCTACGACCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-4165s1c1
Sequence:CCGGGCAGGTGGAAATACGAATGTTCTCGAGAACATTCGTATTTCCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003743
VALIDATED
NCOA1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-1996s21c1
Sequence:CCGGGCTGAGTCCAAAGATAACAAACTCGAGTTTGTTATCTTTGGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-3620s21c1
Sequence:CCGGACCGACAGAGGCAGCTAATACCTCGAGGTATTAGCTGCCTCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-2189s21c1
Sequence:CCGGAGTTACGGCATGCTGATATAGCTCGAGCTATATCAGCATGCCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003743.4-4687s21c1
Sequence:CCGGCTTCAGGTCGTAGCATTTGGACTCGAGTCCAAATGCTACGACCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003743.x-1939s1c1
Sequence:CCGGGCTGAGTCCAAAGATAACAAACTCGAGTTTGTTATCTTTGGACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-1536s1c1
Sequence:CCGGCGGAAGTCAGATTGTAGCCAACTCGAGTTGGCTACAATCTGACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-3165s1c1
Sequence:CCGGCAACCTTTATTCCCAGCCTTACTCGAGTAAGGCTGGGAATAAAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003743.x-4630s1c1
Sequence:CCGGCTTCAGGTCGTAGCATTTGGACTCGAGTCCAAATGCTACGACCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-4165s1c1
Sequence:CCGGGCAGGTGGAAATACGAATGTTCTCGAGAACATTCGTATTTCCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003743
VALIDATED
NCOA1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-1996s21c1
Sequence:CCGGGCTGAGTCCAAAGATAACAAACTCGAGTTTGTTATCTTTGGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-3620s21c1
Sequence:CCGGACCGACAGAGGCAGCTAATACCTCGAGGTATTAGCTGCCTCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003743.4-2189s21c1
Sequence:CCGGAGTTACGGCATGCTGATATAGCTCGAGCTATATCAGCATGCCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003743.4-4687s21c1
Sequence:CCGGCTTCAGGTCGTAGCATTTGGACTCGAGTCCAAATGCTACGACCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003743.x-1939s1c1
Sequence:CCGGGCTGAGTCCAAAGATAACAAACTCGAGTTTGTTATCTTTGGACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-1536s1c1
Sequence:CCGGCGGAAGTCAGATTGTAGCCAACTCGAGTTGGCTACAATCTGACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-3165s1c1
Sequence:CCGGCAACCTTTATTCCCAGCCTTACTCGAGTAAGGCTGGGAATAAAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003743.x-4630s1c1
Sequence:CCGGCTTCAGGTCGTAGCATTTGGACTCGAGTCCAAATGCTACGACCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003743.x-4165s1c1
Sequence:CCGGGCAGGTGGAAATACGAATGTTCTCGAGAACATTCGTATTTCCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks