EMAIL THIS PAGE TO A FRIEND

NCOA5

nuclear receptor coactivator 5

Synonyms: CIA bA465L10.6
Gene ID:
Human(57727) Summary: This gene encodes a coregulator for the alpha and beta estrogen receptors and the orphan nuclear receptor NR1D2. The protein localizes to the nucleus, and is thought to have both coactivator and corepressor functions. Its interaction with nuclear receptors is independent of the AF2 domain on the receptors, which is known to regulate interaction with other coreceptors. Two alternatively spliced transcript variants for this gene have been described. However, the full length nature of one of the variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(228869) nuclear receptor coactivator 5
Rat(296372) nuclear receptor coactivator 5
Zebrafish(447849) nuclear receptor coactivator 5
chicken(419304) nuclear receptor coactivator 5
dog(477250) nuclear receptor coactivator 5
cow(540762) nuclear receptor coactivator 5
Horse(100056647) nuclear receptor coactivator 5
domestic cat(101083924) nuclear receptor coactivator 5
domestic guinea pig(100722150) nuclear receptor coactivator 5
naked mole-rat(101716320) nuclear receptor coactivator 5
sheep(101117267) nuclear receptor coactivator 5
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020967 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020967 Rosetta Predictions human pricing
NM_001106543 Rosetta Predictions rat pricing
NM_144892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172441 predicted 1022
2 SASI_Hs01_00172442 predicted 626
3 SASI_Hs01_00172444 predicted 1588
4 SASI_Hs01_00172445 predicted 429
5 SASI_Hs01_00172446 predicted 471
6 SASI_Hs01_00172447 predicted 1017
7 SASI_Hs01_00172448 predicted 862
8 SASI_Hs01_00172450 predicted 1056
9 SASI_Hs02_00354397 predicted 216
10 SASI_Hs02_00354398 predicted 1748
11 SASI_Hs01_00172443 predicted 477
12 SASI_Hs01_00172449 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219988 predicted 1865
2 SASI_Rn02_00219989 predicted 1846
3 SASI_Rn02_00219990 predicted 1134
4 SASI_Rn02_00219991 predicted 648
5 SASI_Rn02_00219992 predicted 352
6 SASI_Rn02_00219993 predicted 537
7 SASI_Rn02_00219994 predicted 794
8 SASI_Rn02_00219995 predicted 678
9 SASI_Rn02_00219996 predicted 832
10 SASI_Rn02_00219997 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143880 predicted 448
2 SASI_Mm01_00143881 predicted 213
3 SASI_Mm01_00143882 predicted 397
4 SASI_Mm01_00143883 predicted 698
5 SASI_Mm01_00143884 predicted 660
6 SASI_Mm01_00143885 predicted 1167
7 SASI_Mm01_00143886 predicted 993
8 SASI_Mm01_00143887 predicted 297
9 SASI_Mm01_00143888 predicted 1575
10 SASI_Mm01_00143889 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020967
NCOA5 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020967.2-2056s21c1
Sequence:CCGGGCTTATTCCTTACAAAGTTTACTCGAGTAAACTTTGTAAGGAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020967.2-1871s21c1
Sequence:CCGGGGATCTTACCAGAGGCATTACCTCGAGGTAATGCCTCTGGTAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020967.2-415s21c1
Sequence:CCGGTAGAGACTTTCGTGATCTAAGCTCGAGCTTAGATCACGAAAGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-312s1c1
Sequence:CCGGCCACAGACATAGTAGAGATTTCTCGAGAAATCTCTACTATGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-714s1c1
Sequence:CCGGGCCCGTTGATTGTTCTGTGATCTCGAGATCACAGAACAATCAACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-536s1c1
Sequence:CCGGGCAGGAGAAAGGATGACTCTTCTCGAGAAGAGTCATCCTTTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-649s1c1
Sequence:CCGGCGGCGTAGAGAAGAGCTTTATCTCGAGATAAAGCTCTTCTCTACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-1544s1c1
Sequence:CCGGCTCAACAAAGATCACAGGCTTCTCGAGAAGCCTGTGATCTTTGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020967
NCOA5 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020967.2-2056s21c1
Sequence:CCGGGCTTATTCCTTACAAAGTTTACTCGAGTAAACTTTGTAAGGAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020967.2-1871s21c1
Sequence:CCGGGGATCTTACCAGAGGCATTACCTCGAGGTAATGCCTCTGGTAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020967.2-415s21c1
Sequence:CCGGTAGAGACTTTCGTGATCTAAGCTCGAGCTTAGATCACGAAAGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-312s1c1
Sequence:CCGGCCACAGACATAGTAGAGATTTCTCGAGAAATCTCTACTATGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-714s1c1
Sequence:CCGGGCCCGTTGATTGTTCTGTGATCTCGAGATCACAGAACAATCAACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-536s1c1
Sequence:CCGGGCAGGAGAAAGGATGACTCTTCTCGAGAAGAGTCATCCTTTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-649s1c1
Sequence:CCGGCGGCGTAGAGAAGAGCTTTATCTCGAGATAAAGCTCTTCTCTACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-1544s1c1
Sequence:CCGGCTCAACAAAGATCACAGGCTTCTCGAGAAGCCTGTGATCTTTGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020967
NCOA5 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020967.2-2056s21c1
Sequence:CCGGGCTTATTCCTTACAAAGTTTACTCGAGTAAACTTTGTAAGGAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020967.2-1871s21c1
Sequence:CCGGGGATCTTACCAGAGGCATTACCTCGAGGTAATGCCTCTGGTAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020967.2-415s21c1
Sequence:CCGGTAGAGACTTTCGTGATCTAAGCTCGAGCTTAGATCACGAAAGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-312s1c1
Sequence:CCGGCCACAGACATAGTAGAGATTTCTCGAGAAATCTCTACTATGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-714s1c1
Sequence:CCGGGCCCGTTGATTGTTCTGTGATCTCGAGATCACAGAACAATCAACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-536s1c1
Sequence:CCGGGCAGGAGAAAGGATGACTCTTCTCGAGAAGAGTCATCCTTTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-649s1c1
Sequence:CCGGCGGCGTAGAGAAGAGCTTTATCTCGAGATAAAGCTCTTCTCTACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020967.1-1544s1c1
Sequence:CCGGCTCAACAAAGATCACAGGCTTCTCGAGAAGCCTGTGATCTTTGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144892
VALIDATED
NCOA5 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144892.1-387s21c1
Sequence:CCGGTCGGGACTTTCGTGATCTAAGCTCGAGCTTAGATCACGAAAGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-2007s21c1
Sequence:CCGGCGGCTGTTGCTTATCACTTATCTCGAGATAAGTGATAAGCAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144892.1-156s21c1
Sequence:CCGGCACACGAAGGGATCCCTATAGCTCGAGCTATAGGGATCCCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-649s21c1
Sequence:CCGGCGACGTAGAGAGGAGCTTTATCTCGAGATAAAGCTCCTCTCTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-565s21c1
Sequence:CCGGCGGTACAGAGATAGCTTTGATCTCGAGATCAAAGCTATCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144892.1-2412s1c1
Sequence:CCGGCCCTTGAAGTTGGTTTGGTTTCTCGAGAAACCAAACCAACTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144892.1-1704s1c1
Sequence:CCGGGCCTGTATCTTCCACAGGTATCTCGAGATACCTGTGGAAGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-649s1c1
Sequence:CCGGCGACGTAGAGAGGAGCTTTATCTCGAGATAAAGCTCCTCTCTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-565s1c1
Sequence:CCGGCGGTACAGAGATAGCTTTGATCTCGAGATCAAAGCTATCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-714s1c1
Sequence:CCGGGCCTGTGGATTGCTCAGTTATCTCGAGATAACTGAGCAATCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144892
VALIDATED
NCOA5 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144892.1-387s21c1
Sequence:CCGGTCGGGACTTTCGTGATCTAAGCTCGAGCTTAGATCACGAAAGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-2007s21c1
Sequence:CCGGCGGCTGTTGCTTATCACTTATCTCGAGATAAGTGATAAGCAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144892.1-156s21c1
Sequence:CCGGCACACGAAGGGATCCCTATAGCTCGAGCTATAGGGATCCCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-649s21c1
Sequence:CCGGCGACGTAGAGAGGAGCTTTATCTCGAGATAAAGCTCCTCTCTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-565s21c1
Sequence:CCGGCGGTACAGAGATAGCTTTGATCTCGAGATCAAAGCTATCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144892.1-2412s1c1
Sequence:CCGGCCCTTGAAGTTGGTTTGGTTTCTCGAGAAACCAAACCAACTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144892.1-1704s1c1
Sequence:CCGGGCCTGTATCTTCCACAGGTATCTCGAGATACCTGTGGAAGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-649s1c1
Sequence:CCGGCGACGTAGAGAGGAGCTTTATCTCGAGATAAAGCTCCTCTCTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-565s1c1
Sequence:CCGGCGGTACAGAGATAGCTTTGATCTCGAGATCAAAGCTATCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-714s1c1
Sequence:CCGGGCCTGTGGATTGCTCAGTTATCTCGAGATAACTGAGCAATCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144892
VALIDATED
NCOA5 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144892.1-387s21c1
Sequence:CCGGTCGGGACTTTCGTGATCTAAGCTCGAGCTTAGATCACGAAAGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-2007s21c1
Sequence:CCGGCGGCTGTTGCTTATCACTTATCTCGAGATAAGTGATAAGCAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144892.1-156s21c1
Sequence:CCGGCACACGAAGGGATCCCTATAGCTCGAGCTATAGGGATCCCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-649s21c1
Sequence:CCGGCGACGTAGAGAGGAGCTTTATCTCGAGATAAAGCTCCTCTCTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144892.1-565s21c1
Sequence:CCGGCGGTACAGAGATAGCTTTGATCTCGAGATCAAAGCTATCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144892.1-2412s1c1
Sequence:CCGGCCCTTGAAGTTGGTTTGGTTTCTCGAGAAACCAAACCAACTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144892.1-1704s1c1
Sequence:CCGGGCCTGTATCTTCCACAGGTATCTCGAGATACCTGTGGAAGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-649s1c1
Sequence:CCGGCGACGTAGAGAGGAGCTTTATCTCGAGATAAAGCTCCTCTCTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-565s1c1
Sequence:CCGGCGGTACAGAGATAGCTTTGATCTCGAGATCAAAGCTATCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144892.1-714s1c1
Sequence:CCGGGCCTGTGGATTGCTCAGTTATCTCGAGATAACTGAGCAATCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks