EMAIL THIS PAGE TO A FRIEND

NCR1

natural cytotoxicity triggering receptor 1

Synonyms: CD335 LY94 NK-p46 NKP46
Gene ID:
Mouse(17086) natural cytotoxicity triggering receptor 1
Rat(117547) natural cytotoxicity triggering receptor 1
domestic cat(101094307) natural cytotoxicity triggering receptor 1
cow(369024) natural cytotoxicity triggering receptor 1
Horse(100054918) natural cytotoxicity triggering receptor 1
dog(611390) natural cytotoxicity triggering receptor 1
sheep(100526763) natural cytotoxicity triggering receptor 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004829 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071021 MISSION® esiRNA esiRNA human NCR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004829 Rosetta Predictions human pricing
NM_057199 Rosetta Predictions rat pricing
NM_010746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061691 predicted 345
2 SASI_Hs01_00061693 predicted 300
3 SASI_Hs01_00061694 predicted 757
4 SASI_Hs01_00061695 predicted 244
5 SASI_Hs02_00338399 predicted 788
6 SASI_Hs02_00338400 predicted 887
7 SASI_Hs01_00061696 predicted 341
8 SASI_Hs01_00061697 predicted 298
9 SASI_Hs01_00061698 predicted 630
10 SASI_Hs01_00061699 predicted 361
11 SASI_Hs01_00061692 predicted 694
12 SASI_Hs01_00061700 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267147 predicted 700
2 SASI_Rn01_00090553 predicted 940
3 SASI_Rn01_00090556 predicted 349
4 SASI_Rn01_00090557 predicted 860
5 SASI_Rn01_00090558 predicted 901
6 SASI_Rn01_00090559 predicted 287
7 SASI_Rn01_00090560 predicted 926
8 SASI_Rn01_00090561 predicted 232
9 SASI_Rn02_00267148 predicted 673
10 SASI_Rn02_00267149 predicted 269
11 SASI_Rn01_00090554 predicted 255
12 SASI_Rn01_00090555 predicted 491
13 SASI_Rn01_00090562 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124379 predicted 366
2 SASI_Mm01_00124380 predicted 495
3 SASI_Mm01_00124381 predicted 714
4 SASI_Mm01_00124382 predicted 727
5 SASI_Mm01_00124383 predicted 916
6 SASI_Mm01_00124384 predicted 811
7 SASI_Mm01_00124385 predicted 686
8 SASI_Mm01_00124386 predicted 288
9 SASI_Mm01_00124387 predicted 301
10 SASI_Mm01_00124388 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010746
NCR1 MISSION shRNA Bacterial Glycerol Stock
natural cytotoxicity triggering receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010746.2-1155s1c1
Sequence:CCGGCGCTTATTTACTGCAAGTTATCTCGAGATAACTTGCAGTAAATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-245s1c1
Sequence:CCGGGCCATCGAGATCGATGAATAACTCGAGTTATTCATCGATCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-73s1c1
Sequence:CCGGGCCAGAGGATCAACACTGAAACTCGAGTTTCAGTGTTGATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-736s1c1
Sequence:CCGGCCAATGAATCAGGATTACAAACTCGAGTTTGTAATCCTGATTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-695s1c1
Sequence:CCGGCCCTACTTCTTCTCTTGATTACTCGAGTAATCAAGAGAAGAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010746
NCR1 MISSION shRNA shRNA Plasmid DNA
natural cytotoxicity triggering receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010746.2-1155s1c1
Sequence:CCGGCGCTTATTTACTGCAAGTTATCTCGAGATAACTTGCAGTAAATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-245s1c1
Sequence:CCGGGCCATCGAGATCGATGAATAACTCGAGTTATTCATCGATCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-73s1c1
Sequence:CCGGGCCAGAGGATCAACACTGAAACTCGAGTTTCAGTGTTGATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-736s1c1
Sequence:CCGGCCAATGAATCAGGATTACAAACTCGAGTTTGTAATCCTGATTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-695s1c1
Sequence:CCGGCCCTACTTCTTCTCTTGATTACTCGAGTAATCAAGAGAAGAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010746
NCR1 MISSION shRNA Lentiviral Transduction Particles
natural cytotoxicity triggering receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010746.2-1155s1c1
Sequence:CCGGCGCTTATTTACTGCAAGTTATCTCGAGATAACTTGCAGTAAATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-245s1c1
Sequence:CCGGGCCATCGAGATCGATGAATAACTCGAGTTATTCATCGATCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-73s1c1
Sequence:CCGGGCCAGAGGATCAACACTGAAACTCGAGTTTCAGTGTTGATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-736s1c1
Sequence:CCGGCCAATGAATCAGGATTACAAACTCGAGTTTGTAATCCTGATTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010746.2-695s1c1
Sequence:CCGGCCCTACTTCTTCTCTTGATTACTCGAGTAATCAAGAGAAGAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004829
NCR1 MISSION shRNA Bacterial Glycerol Stock
natural cytotoxicity triggering receptor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-267s1c1
Sequence:CCGGGCGGATTAACAAAGTCAAATTCTCGAGAATTTGACTTTGTTAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-480s1c1
Sequence:CCGGCACTGCAACAAGCATGTTCTTCTCGAGAAGAACATGCTTGTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-176s1c1
Sequence:CCGGCCATCTGTTGCCAGGGAAATTCTCGAGAATTTCCCTGGCAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-371s1c1
Sequence:CCGGACTTGCTGGATCTGGTGGTAACTCGAGTTACCACCAGATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-591s1c1
Sequence:CCGGCCGAGGGACATACCGATGTTTCTCGAGAAACATCGGTATGTCCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004829
NCR1 MISSION shRNA shRNA Plasmid DNA
natural cytotoxicity triggering receptor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-267s1c1
Sequence:CCGGGCGGATTAACAAAGTCAAATTCTCGAGAATTTGACTTTGTTAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-480s1c1
Sequence:CCGGCACTGCAACAAGCATGTTCTTCTCGAGAAGAACATGCTTGTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-176s1c1
Sequence:CCGGCCATCTGTTGCCAGGGAAATTCTCGAGAATTTCCCTGGCAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-371s1c1
Sequence:CCGGACTTGCTGGATCTGGTGGTAACTCGAGTTACCACCAGATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-591s1c1
Sequence:CCGGCCGAGGGACATACCGATGTTTCTCGAGAAACATCGGTATGTCCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004829
NCR1 MISSION shRNA Lentiviral Transduction Particles
natural cytotoxicity triggering receptor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-267s1c1
Sequence:CCGGGCGGATTAACAAAGTCAAATTCTCGAGAATTTGACTTTGTTAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-480s1c1
Sequence:CCGGCACTGCAACAAGCATGTTCTTCTCGAGAAGAACATGCTTGTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-176s1c1
Sequence:CCGGCCATCTGTTGCCAGGGAAATTCTCGAGAATTTCCCTGGCAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-371s1c1
Sequence:CCGGACTTGCTGGATCTGGTGGTAACTCGAGTTACCACCAGATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004829.3-591s1c1
Sequence:CCGGCCGAGGGACATACCGATGTTTCTCGAGAAACATCGGTATGTCCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks