EMAIL THIS PAGE TO A FRIEND

NDOR1

NADPH dependent diflavin oxidoreductase 1

Synonyms: NR1 bA350O14.9
UniProtKB ID: Q9UHB4, D3YTH9, Q5VSG4, Q86US9, Q96BC6
Gene ID:
Human(27158) Summary: This gene encodes an NADPH-dependent diflavin reductase that contains both flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) binding domains. The encoded protein catalyzes the transfer of electrons from NADPH through FAD and FMN cofactors to potential redox partners. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Mouse(78797) NADPH dependent diflavin oxidoreductase 1
Rat(311799) NADPH dependent diflavin oxidoreductase 1
sheep(101108823) NADPH dependent diflavin oxidoreductase 1
domestic guinea pig(100729103) NADPH dependent diflavin oxidoreductase 1
naked mole-rat(101716838) NADPH dependent diflavin oxidoreductase 1
Zebrafish(393621) NADPH dependent diflavin oxidoreductase 1
dog(491234) NADPH dependent diflavin oxidoreductase 1
domestic cat(101101600) NADPH dependent diflavin oxidoreductase 1
cow(513873) NADPH dependent diflavin oxidoreductase 1
chicken(417280) NADPH dependent diflavin oxidoreductase 1
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001082476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001082476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001082476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014434 Rosetta Predictions human pricing
XM_001716570 Rosetta Predictions human pricing
NM_001107818 Rosetta Predictions rat pricing
NM_001082476 Rosetta Predictions mouse pricing
NM_178239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132194 predicted 1145
2 SASI_Hs01_00132195 predicted 1032
3 SASI_Hs01_00132196 predicted 1383
4 SASI_Hs01_00132198 predicted 719
5 SASI_Hs01_00132199 predicted 1730
6 SASI_Hs01_00132200 predicted 260
7 SASI_Hs02_00345641 predicted 1804
8 SASI_Hs01_00132201 predicted 855
9 SASI_Hs01_00132202 predicted 205
10 SASI_Hs01_00132203 predicted 2063
11 SASI_Hs01_00132197 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411502 predicted 311
2 SASI_Hs02_00411503 predicted 306
3 SASI_Hs02_00411504 predicted 327
4 SASI_Hs02_00411505 predicted 210
5 SASI_Hs02_00411506 predicted 215
6 SASI_Hs02_00411507 predicted 215
7 SASI_Hs02_00411508 predicted 349
8 SASI_Hs02_00411509 predicted 250
9 SASI_Hs02_00411510 predicted 349
10 SASI_Hs02_00411511 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232575 predicted 281
2 SASI_Rn02_00232576 predicted 227
3 SASI_Rn02_00232577 predicted 1499
4 SASI_Rn02_00232578 predicted 1727
5 SASI_Rn02_00232579 predicted 1727
6 SASI_Rn02_00232580 predicted 768
7 SASI_Rn02_00232581 predicted 1937
8 SASI_Rn02_00232582 predicted 1923
9 SASI_Rn02_00232583 predicted 589
10 SASI_Rn02_00232584 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299252 predicted 1925
2 SASI_Mm02_00299253 predicted 359
3 SASI_Mm02_00299254 predicted 1535
4 SASI_Mm02_00299255 predicted 737
5 SASI_Mm02_00299256 predicted 273
6 SASI_Mm02_00299257 predicted 745
7 SASI_Mm02_00299258 predicted 1914
8 SASI_Mm02_00299259 predicted 1046
9 SASI_Mm02_00299260 predicted 1553
10 SASI_Mm02_00299261 predicted 1836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021042 predicted 416
2 SASI_Mm01_00021043 predicted 794
3 SASI_Mm01_00021044 predicted 316
4 SASI_Mm01_00021045 predicted 331
5 SASI_Mm01_00021046 predicted 237
6 SASI_Mm01_00021047 predicted 800
7 SASI_Mm01_00021048 predicted 1102
8 SASI_Mm01_00021049 predicted 274
9 SASI_Mm01_00021050 predicted 870
10 SASI_Mm01_00021051 predicted 1197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014434
VALIDATED
NDOR1 MISSION shRNA Bacterial Glycerol Stock
NADPH dependent diflavin oxidoreductase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-405s21c1
Sequence:CCGGGGACTCCTCATACGCCAAGTTCTCGAGAACTTGGCGTATGAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-274s21c1
Sequence:CCGCATATTTGTTTGTGCAACTACACTCGAGTGTAGTTGCACAAACAAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-1791s21c1
Sequence:CCGGGGAAGCCCTGATGTCCATCTTCTCGAGAAGATGGACATCAGGGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-257s1c1
Sequence:CCGGGAAGAACTTCTGGAGGTTTATCTCGAGATAAACCTCCAGAAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1604s1c1
Sequence:CCGGGCAGAAAGTATATGTGCAGCACTCGAGTGCTGCACATATACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1259s1c1
Sequence:CCGGGCAGTTCCAGACTCGCCTCAACTCGAGTTGAGGCGAGTCTGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-176s1c1
Sequence:CCGGCCCGGTGGTGAATCTGATTAACTCGAGTTAATCAGATTCACCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1475s1c1
Sequence:CCGGCCAGACTGGAAACTTCTTGTTCTCGAGAACAAGAAGTTTCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014434
VALIDATED
NDOR1 MISSION shRNA shRNA Plasmid DNA
NADPH dependent diflavin oxidoreductase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-405s21c1
Sequence:CCGGGGACTCCTCATACGCCAAGTTCTCGAGAACTTGGCGTATGAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-274s21c1
Sequence:CCGCATATTTGTTTGTGCAACTACACTCGAGTGTAGTTGCACAAACAAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-1791s21c1
Sequence:CCGGGGAAGCCCTGATGTCCATCTTCTCGAGAAGATGGACATCAGGGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-257s1c1
Sequence:CCGGGAAGAACTTCTGGAGGTTTATCTCGAGATAAACCTCCAGAAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1604s1c1
Sequence:CCGGGCAGAAAGTATATGTGCAGCACTCGAGTGCTGCACATATACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1259s1c1
Sequence:CCGGGCAGTTCCAGACTCGCCTCAACTCGAGTTGAGGCGAGTCTGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-176s1c1
Sequence:CCGGCCCGGTGGTGAATCTGATTAACTCGAGTTAATCAGATTCACCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1475s1c1
Sequence:CCGGCCAGACTGGAAACTTCTTGTTCTCGAGAACAAGAAGTTTCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014434
VALIDATED
NDOR1 MISSION shRNA Lentiviral Transduction Particles
NADPH dependent diflavin oxidoreductase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-405s21c1
Sequence:CCGGGGACTCCTCATACGCCAAGTTCTCGAGAACTTGGCGTATGAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-274s21c1
Sequence:CCGCATATTTGTTTGTGCAACTACACTCGAGTGTAGTTGCACAAACAAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014434.2-1791s21c1
Sequence:CCGGGGAAGCCCTGATGTCCATCTTCTCGAGAAGATGGACATCAGGGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-257s1c1
Sequence:CCGGGAAGAACTTCTGGAGGTTTATCTCGAGATAAACCTCCAGAAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1604s1c1
Sequence:CCGGGCAGAAAGTATATGTGCAGCACTCGAGTGCTGCACATATACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1259s1c1
Sequence:CCGGGCAGTTCCAGACTCGCCTCAACTCGAGTTGAGGCGAGTCTGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-176s1c1
Sequence:CCGGCCCGGTGGTGAATCTGATTAACTCGAGTTAATCAGATTCACCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014434.1-1475s1c1
Sequence:CCGGCCAGACTGGAAACTTCTTGTTCTCGAGAACAAGAAGTTTCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082476
NDOR1 MISSION shRNA Bacterial Glycerol Stock
NADPH dependent diflavin oxidoreductase 1
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000440515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082476.1-1725s21c1
Sequence:CCGGATATTTGCCTACGGATGTTTCCTCGAGGAAACATCCGTAGGCAAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082476.1-2306s21c1
Sequence:CCGGGTCTGTCTGCAGGTCCATAAACTCGAGTTTATGGACCTGCAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082476
NDOR1 MISSION shRNA shRNA Plasmid DNA
NADPH dependent diflavin oxidoreductase 1
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000440515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082476.1-1725s21c1
Sequence:CCGGATATTTGCCTACGGATGTTTCCTCGAGGAAACATCCGTAGGCAAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082476.1-2306s21c1
Sequence:CCGGGTCTGTCTGCAGGTCCATAAACTCGAGTTTATGGACCTGCAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082476
NDOR1 MISSION shRNA Lentiviral Transduction Particles
NADPH dependent diflavin oxidoreductase 1
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000440515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082476.1-1725s21c1
Sequence:CCGGATATTTGCCTACGGATGTTTCCTCGAGGAAACATCCGTAGGCAAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082476.1-2306s21c1
Sequence:CCGGGTCTGTCTGCAGGTCCATAAACTCGAGTTTATGGACCTGCAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178239
NDOR1 MISSION shRNA Bacterial Glycerol Stock
NADPH dependent diflavin oxidoreductase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000042209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-219s1c1
Sequence:CCGGCCTTACATCTACTTGTGTCTTCTCGAGAAGACACAAGTAGATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-1317s1c1
Sequence:CCGGGCTGTGGTAAAGTACCAGACTCTCGAGAGTCTGGTACTTTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-632s1c1
Sequence:CCGGCTCCAAGTTCATCTTTCAGTTCTCGAGAACTGAAAGATGAACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-308s1c1
Sequence:CCGGCCCTCCTGACAACATGAAGAACTCGAGTTCTTCATGTTGTCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178239
NDOR1 MISSION shRNA shRNA Plasmid DNA
NADPH dependent diflavin oxidoreductase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000042209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-219s1c1
Sequence:CCGGCCTTACATCTACTTGTGTCTTCTCGAGAAGACACAAGTAGATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-1317s1c1
Sequence:CCGGGCTGTGGTAAAGTACCAGACTCTCGAGAGTCTGGTACTTTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-632s1c1
Sequence:CCGGCTCCAAGTTCATCTTTCAGTTCTCGAGAACTGAAAGATGAACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-308s1c1
Sequence:CCGGCCCTCCTGACAACATGAAGAACTCGAGTTCTTCATGTTGTCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178239
NDOR1 MISSION shRNA Lentiviral Transduction Particles
NADPH dependent diflavin oxidoreductase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000042209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-219s1c1
Sequence:CCGGCCTTACATCTACTTGTGTCTTCTCGAGAAGACACAAGTAGATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-1317s1c1
Sequence:CCGGGCTGTGGTAAAGTACCAGACTCTCGAGAGTCTGGTACTTTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-632s1c1
Sequence:CCGGCTCCAAGTTCATCTTTCAGTTCTCGAGAACTGAAAGATGAACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178239.2-308s1c1
Sequence:CCGGCCCTCCTGACAACATGAAGAACTCGAGTTCTTCATGTTGTCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks